SGN Marker TG174

SGN-M138

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1660
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGCGATCTTCCAAGATCTTTTAGCGTCTCTAGTGGAAGATGTATAAAAGTACAATTTTCACCTTAAGAAATTTTTGTTTTTTTTTTCTT
CTTTTCCCCCAAAAAAGGCTAATTATGGCACATATATAAGCAATCTCATCCTAGATTAACACAAGCACACATTTTCCAATCTGCAAAGGC
AAAAGTAGCCCAAACCACATATTAAGTAGTTTATTCTGATTTTCCCCTTGTTGCAACAATCAGACTTACCTACCCATGCACCCCACCAGA
AATGAACAGAAAAGTCAGATGTTAGCATCGACGCCAAAGCAGAACTTCTATTAAATTCCAGAATGAGGTCCTAGATAAAGAGATTATAAG
TTATTAGAGGAATTACCTCAGAAATATAAATTGGAACTAGTACTGTATTAACACCAATTCCAAGGCCAACAAGGAATCTTCCCAAGATCA
TTTCTTC
Reverse sequence
AGCACATTACATGTACAAACCATCTCAAGCGATCTTCTCTCATTTTATCCTCAATGTGTGTTAGTTGCACCTGTTGCGGATGTGATCATT
TCTAATCTTGTATGTACACACAACCATCTCAACATCCACATCTTTTATTATACTCATCTTGTGGAGTGTTGGATTTTACCGGCCCAACTC
ACTTGCATATAAAATTATTGCTCTTACAATTATTCTATAAAATCTTTCTTTCACTCCGGTAGGAATTCTTCTATGAGGTAACACCCTGAC
AGCTCTTCTTTATTTCTACCATCCTATTTTGATTTAATATGTATCATTCTTTTTTACATAAGGTACTGTTGTATTCCTCAGCATTAAGGA
ATGCTGGCCACCTCCAAAAATTGTTACAGAAACAGAAAATAGAAACTTCATTTACAAAGCTCCTAAGAACTCTACAACCCCCCTCTTCTG
ATCCAGCAGCTTAGTAGATTAGCTGTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53518)
Chromosome
7
Position
50.68 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53198)
Chromosome
7
Position
25.17 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43841)
Chromosome
7
Position
54.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43301)
Chromosome
7
Position
52.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40840)
Chromosome
7
Position
60.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36572
Forward primer (5'-3')
CTGTTGCGGATGTGATCATT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGCTGCTGGATCAGAAGAGG
Digested band sizes (using HpaII)
Solanum pennellii TA56
280
Solanum lycopersicum TA209
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39923)
Chromosome
7
Position
40.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8265)
Chromosome
7
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8268)
Chromosome
7
Position
65.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 13993
Forward primer (5'-3')
TTCCAAGATCTTTTAGCGTCTC
Digested band sizes (using MspI)
Solanum pennellii LA716: 600+900
Solanum lycopersicum LA925: 1500
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGTTGCGGATGTGATCATT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13993
Forward primer (5'-3')
TTCCAAGATCTTTTAGCGTCTC
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 600+900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGTTGCGGATGTGATCATT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 14126
Forward primer (5'-3')
TTCCAAGATCTTTTAGCGTCTC
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 1500
Solanum pimpinellifolium LA1589: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGTTGCGGATGTGATCATT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 91
Forward primer (5'-3')
Unknown
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 600+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG174 was used as an overgo probe on plate 9 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGCGATCTTCCAAGATCTTTTAG
B sequence
TCTTCCACTAGAGACGCTAAAAGA
AB sequence
CAGCGATCTTCCAAGATCTTTTAGCGTCTC
Marker sequence
CAGCGATCTTCCAAGATCTTTTAGCGTCTCTAGTGGAAGATGTATAAAAG
TACAATTTTCACCTTAAGAAATTTTTGTTTTTTTTTTCTTCTTTTCCCCC
AAAAAAGGCTAATTATGGCACATATATAAGCAATCTCATCCTAGATTAAC
ACAAGCACACATTTTCCAATCTGCAAAGGCAAAAGTAGCCCAAACCACAT
ATTAAGTAGTTTATTCTGATTTTCCCCTTGTTGCAACAATCAGACTTACC
TACCCATGCACCCCACCAGAAATGAACAGAAAAGTCAGATGTTAGCATCG
ACGCCAAAGCAGAACTTCTATTAAATTCCAGAATGAGGTCCTAGATAAAG
AGATTATAAGTTATTAGAGGAATTACCTCAGAAATATAAATTGGAACTAG
TACTGTATTAACACCAATTCCAAGGCCAACAAGGAATCTTCCCAAGATCA
TTTCTTC
Genomic location of TG174  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D138 marker 138
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)