SGN Marker T0208

SGN-M1381
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TSHAG09TH
Arabidopsis best BAC match: AC002329.2
Arabidopsis position: 2.1010000
Arabidopsis identities: 0.765
Best GenBank protein hit: AAD33097.1
Evalue: 1.3e-33
Identities: 0.768
Description: homoserine kinase [Arabidopsis thaliana]
Comment: Thr biosynthesis from aspartate
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49500)
Chromosome
4
Position
2.41 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47434)
Chromosome
4
Position
15.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39324)
Chromosome
4
Position
19.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0208 was used as an overgo probe on plate 7 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCACCAACTCGATCAAGCTTCTTC
B sequence
AGGCTTTGGCTATGGTGAAGAAGC
AB sequence
GCACCAACTCGATCAAGCTTCTTCACCATA
Marker sequence
GGCACGAGGACAAGTAAGCCATTTCAAAATGGCAACTTTTTAACTATTTT
ATTTGCTCGGTAATCAACTGATTTCTCAATGATCAATACAACGACGACAC
ATCAAGTGTGATCCCACAAGTAAGATATGGGAAGGGTAGAGTGTACGCAG
ACCATATACCCCTATCTTGTGTGACAGAGAGGCAATTTCCGATAGACAGC
TCAAAAAAACATTTCAAAACATGTTTGAAAAATACAAAGTGAAAGAAGCT
CTAACAATTCATTGCACACAAATTCCTACATATCATTTTTCACATAGCAT
GATGAATTCATATAGTGAAAAGATATATATAGGATTCATACAACTAATAC
CAAACTCGTTTGGAATTGAGGCATAGTTGATTGATTGATTGATCCATCGA
TCATCGTGAATTGCTACTAACAAGGCGGGCACCAACTCGATCAAGCTTCT
TCACCATAGCCAAAGCCTTCAAGTTCCCTTCCTTCATAAACGCCTCCACC
ATTCTCTCCCCAATCTCCCTCCCTCTCTCTTCATCATCCGTCACCGCGAC
CAAAGTAGGTCCAGCTCCGCTTATCGTGCAACCAAATGCCCCAGCCTTCA
ACGCCGCCTTCTTCACTCCCTCCATCCCAGGAATCAACGGCCCTCTCCTC
GGCTCCACAATCTTATCAGACGACAACGCCTTCCCTAAACCCCTCGAATC
CCCCTGCAATATCGCAGCCACCAACGCCCCA
Genomic location of T0208  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1381 marker 1381
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)