SGN Marker T0214

SGN-M1383
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TSHAK67TH
Arabidopsis best BAC match: AL353994.1
Arabidopsis position: 5.0159000
Arabidopsis identities: 0.876
Best GenBank protein hit: AAC41647.1
Evalue: 3.9e-95
Identities: 0.852
Description: glyoxysomal malate dehydrogenase [Cucumis sativus]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39325)
Chromosome
1
Position
145.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0214 was used as an overgo probe on plate 9 [well C2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCAGGAAGATGCAGCCATCAGGT
B sequence
GTTGGTGAACTTCTGCACCTGATG
AB sequence
ATCAGGAAGATGCAGCCATCAGGTGCAGAA
Marker sequence
TTCGGCACGAGCTCTCATTCCAAAGAATCAGGAAGATGCAGCCATCAGGT
GCAGAAGTTCACCAACGAATAGCCAGAATTTCAGCTCATCTTTACCCTTC
AAATCCCCAGATGGGAGATGGGTCTATTTTGGAAAGAACAAATTGCAGAG
CAAAAGGTGGAGCAGCTGGATTCAAAGTTGCTATACTGGGTGCTGCTGGA
GGAATTGGGCAGCCACTTGCAATGTTGATGAAGATGAATCCTTTAGTCTC
AGTTCTTCATCTCTATGATGTTGTTAATGCTCCTGGTGTTACTGCTGATA
TTAGCCACATGGACACTGGTGCTGTTGTGAGGGGTTTTCTAGGGCAAAGT
GAGCTTGAAGGTGCACTTACAGGAATGGACCTTGTGATCATACCTGCTGG
TATTTCAGGAAAACCTGAAATGACAAGAGATGATCTTTTTAAGATTAATG
CTGGAATTGTGAGGACCCTCTGTGAAGGAATTGCAAAGTGCTGTCCTAAT
GCTATTGTCAATTTGATTAGTAATCCAGTGAACTCCACAGTTCCTATTGC
AGCTGAAGTTTTCAAGATAGCATGCACTTATGATCCAAAGAAGCTTCTTG
GAGTTACCTCACTTGATGTTGTGAGAGCTAACACTTTTGTGGCATAAGTC
TTGGGACTAGATCCT
Genomic location of T0214  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1383 marker 1383
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)