SGN Marker T0244

SGN-M1386
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVAK69TH
Arabidopsis best BAC match: AB012239.1
Arabidopsis position: 5.2660000
Arabidopsis identities: 0.956
Best GenBank protein hit: BAB08995.1
Evalue: 5.2e-42
Identities: 0.964
Description: autophagocytosis protein AUT1-like [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49501)
Chromosome
6
Position
20.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47435)
Chromosome
6
Position
11.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39326)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0244 was used as an overgo probe on plate 2 [well H6]

Plausible BAC Matches:   P234G08,   P007A01,   P126K07,   P196K01,   P138E18,   P243I01,   P214G11,   P110L14,   P267G16,   P156B07,   P295L11,   P267E16,   P120K17,   P114G13

 Non-Plausible BAC matches

P030H14,   P289O15,   P252F09,   P320C10,   P202J10,   P258A04,   P335D15,   P288B07,   P264K19,   P314N23,   P291O11,   P309K01,   P027N22

 Overgo Sequences

A sequence
AGACGGTGACCATTGAAGACCATC
B sequence
TTCCCTGGAAGATGTGGATGGTCT
AB sequence
AGACGGTGACCATTGAAGACCATCCACATC
Marker sequence
GCACCAGAGAACTCGTACTTGAAGATGTCAGTCAAGACCATGCACGCAAG
ACGGTGACCATTGAAGACCATCCACATCTTCCAGGGAAACATGCTTCTGT
GCATCCTTGCCGACATGGGGCTGTGATGAAGAAAATTATTGATGTTTTGA
TGTTGAGAGGAGTTGAACCCGAAGTTGACAAGTATCTTTTCCTGTTCTTG
AAGTTTGTGGCTTCGGTTATTCCAACAATTGAATATGATTACACCATGGA
CTTTGATCTTGGTAGCAGTAGCACCTGATTTGCTGTCAACTTCCTTCGAT
TGATGCTGGCATATAACATGTCAACCAGTCAAATACTCTAATGGCAATAC
CTATTTATAAATTGTACAGTATTTATAAATGTTCTTCTAGAAATGTGGAG
CATGCATGATGAATCGTCAGCATGCCTTGTTTATTTTGTATATTAACAAA
GAATAAAGGTTATTCAAGTTTGCACTTTGCACGATCCACTGCAAGGCTGA
AATTGTTTATTTAAGTTAAAGTTAGCAGGATGAAAGCTACATGAATAGTA
AGTGATGATGTTTGTTTTATGCATCAAATGTCTAGGAATNNNANAAAA
Genomic location of T0244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1386 marker 1386
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)