SGN Marker TG176

SGN-M139

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AACAGATTATCAAAATGATATACTCTAAAAAAAGAAGATACAAGAGTGTCAATGGCAGCAAATAAGCTAATGAAACTAATTGCTTGTAAC
AAGTTATGAACACAAAACCTGTGCAGGCTGTTGAACCGCATTTACACCAGGCATGCCACTTTGAGATGTAGATTCTACAGAAAAGACATC
AGCCGGTTGACCTGCAATTAGTAGGCACAGTGTCCGCAAAGGTGACCCTGCTACTAACTGTTGAAGTGCCATTTGCTTCACCGTTTCTAC
ATAGAACTACAATTATGCAAGAAATCAAAAATATATTGATAGAAATAACCACACACACACACATGTATAATTGAGACATAGAGAGAGAGA
GAGAGAGAGAGAGAGAGCGAGAGAGTGAGAGAGGAGGAAGAAGAGGCTGGGTGCCAAAGGGAAACTAAGAACTAGACAAACCTGATCCCC
AAGTTGTGCAGCAAGAACAAGAGCTG
Reverse sequence
TTAAACAAATAAATAGTAGTGGTAGTAATAGCACTGCCCCACATATAATAACCAAGAGAGAAGAAATTGTAATTAGGAGCTCGCATAATC
ATGTGAGCAGAGCTATGAAGTAGGTTAGATATTGGGCTCTGAACTCTGGAGGAATTTGGGGGGATGTGTTTCTTTGATTTCAACTACAGA
AATACATGAAGCCTCGAGTCAATTGTCATTTGAAGAAATCTTTTGTTAGAATTAACACCATAGCTTGTGGTACTGTAATACCTTTTACAA
ACTAGGAAAGAGTATTGATGTTCTAGCTGTTACATTTTTGATGAACTTATGTAATTTATTCTCTTCACAATATTTGGCTAAACTTGCCGA
AGTTTGCTAAGCTTGCTTTTTTGTGTTCCCTTTTTACCTTGTCAAAAGAAAGTATGTAAAGGTATGTCTTCCTTTTTTTAATGCATTTTA
GATTTTTCATTTTGTACAATCATCTAGCTTGATAGCGTGAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1487814.4e-63145 (30.5% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53519)
Chromosome
8
Position
10.74 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53199)
Chromosome
8
Position
75.71 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50351)
Chromosome
8
Position
1.91 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48286)
Chromosome
8
Position
2.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43842)
Chromosome
8
Position
13.80 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43302)
Chromosome
8
Position
16.60 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40841)
Chromosome
8
Position
8.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36573
Forward primer (5'-3')
AGTAATAGCACTGCCCCACA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTCGGCAAGTTTAGCCAAATA
Digested band sizes (using RsaI)
Solanum lycopersicum TA209
234
Solanum pennellii TA56
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39924)
Chromosome
8
Position
2.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8272)
Chromosome
8b
Position
30.07 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8269)
Chromosome
8
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8275)
Chromosome
8
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8274)
Chromosome
8
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG176 was used as an overgo probe on plate 1 [well A8]

Plausible BAC Matches:   P270A17,   P268N07

 Overgo Sequences

A sequence
AAAACCTGTGCAGGCTGTTGAACC
B sequence
TGCCTGGTGTAAATGCGGTTCAAC
AB sequence
AAAACCTGTGCAGGCTGTTGAACCGCATTT
Marker sequence
AACAGATTATCAAAATGATATACTCTAAAAAAAGAAGATACAAGAGTGTC
AATGGCAGCAAATAAGCTAATGAAACTAATTGCTTGTAACAAGTTATGAA
CACAAAACCTGTGCAGGCTGTTGAACCGCATTTACACCAGGCATGCCACT
TTGAGATGTAGATTCTACAGAAAAGACATCAGCCGGTTGACCTGCAATTA
GTAGGCACAGTGTCCGCAAAGGTGACCCTGCTACTAACTGTTGAAGTGCC
ATTTGCTTCACCGTTTCTACATAGAACTACAATTATGCAAGAAATCAAAA
ATATATTGATAGAAATAACCACACACACACACATGTATAATTGAGACATA
GAGAGAGAGAGAGAGAGAGAGAGAGAGCGAGAGAGTGAGAGAGGAGGAAG
AAGAGGCTGGGTGCCAAAGGGAAACTAAGAACTAGACAAACCTGATCCCC
AAGTTGTGCAGCAAGAACAAGAGCTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG176  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D139 marker 139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)