SGN Marker T0256

SGN-M1390
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TOVAZ40TH
Arabidopsis best BAC match: AB011482.1
Arabidopsis position: 5.2420000
Arabidopsis identities: 0.838
Best GenBank protein hit: BAB08802.1
Evalue: 7.0e-99
Identities: 0.854
Description: xylose isomerase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39818)
Chromosome
7
Position
1.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0256 was used as an overgo probe on plate 7 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATTCCCTGGCTATGGCCAAGAGA
B sequence
AGTTGGCTCTCAGTCTTCTCTTGG
AB sequence
AATTCCCTGGCTATGGCCAAGAGAAGACTG
Marker sequence
CAAAGTCGTGGCCGTGGGAAGATGGCACCAATTCCCTGGCTATGGCCAAG
AGAAGACTGAGAGCCAACTTTGAATTCCTGGAGAAACTTGGAGTAGAAAG
ATGGTGCTTCCACGATAGGGACATCGCTCCAGAGGGAAAGACCCTTGAGG
AAACAAATGCAAACTTGGATGAAGTGGTGGCTCTTGCCAAAGAGCTTCAG
GGAGATAAATTTCATCTTCTGTGGGGTACCGCTCAATTGTTCCTCCAGCC
TCGCTACATGCATGGTGCTGCTACTAGCTCTGAATTAGGTGTATATGCAT
ATGCTGCTGCTCAGGTCAAGAAAGCCATGGAGGTTACACATCATCTTGGG
GGAGAGAATTATGTCTTTTGGGGTGGTCGAGAAGGTTACCAGAGCCTCCT
GAACACAGATATGGAAAGAGAACTTAACCATATGGCAAGGTTCATGGAAG
CTGCTGTCGCTTACAAAAAGAAGATTGGCTTCAATGGAACATTACTAATT
GAACCAAAGCCTCAGGAGCCAACAAAACACCAGTATGACTGGGATGCTGC
CACTTCTGCTAATTTCTTACGCAAATATGGGCTTATAGGAGAGTTCAAAT
TGAACATCGAGTGCAACCATGCCACGTTGGCTGGTCACA
Genomic location of T0256  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1390 marker 1390
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)