SGN Marker T0276

SGN-M1394
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.1
Tomato EST read: TOVCE01THB
Arabidopsis best BAC match: AF058914.1
Arabidopsis position: 5.0600000
Arabidopsis identities: 0.833
Best GenBank protein hit: AAC13597.1
Evalue: 2.8e-90
Identities: 0.833
Description: glutamyl-tRNA synthetase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49504)
Chromosome
1
Position
82.99 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47438)
Chromosome
1
Position
115.73 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39821)
Chromosome
1
Position
124.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0276 was used as an overgo probe on plate 9 [well B5]

Plausible BAC Matches:   P202B09,   P077G24,   P089B11,   P068A16,   P307M01,   P077C12,   P046B14,   P055N09,   P130G02,   P140H01,   P269N13,   P111D21,   P298F04

 Overgo Sequences

A sequence
GAAGGTAGGAAACCGACATCTGAG
B sequence
CCTCAGGAAGATCTACCTCAGATG
AB sequence
GAAGGTAGGAAACCGACATCTGAGGTAGAT
Marker sequence
GAAGGTAGGAAACCGACATCTGAGGTAGATCTTCCTGAGGCAGAAGTTGG
AAAAGTGCGGTTGAGGTTTGCACCAGAACCCAGTGGTTATCTCCATATTG
GTCACTCAAAAGCAGCATTACTGAACCAGTATTTTGCTGAAAGATATCAA
GGGGAAGTTATTATTCGATTTGATGATACAAATCCTGATAAGGAAAGCAA
TGAATTTGTGGATAATCTACTGAAAGATATTGAAACTCTTGGAATTAAGT
ATAGGACTGTGACATATACATCTGATTACTTTCCACAATTAATGGAGATG
GCAGAGAAATTGATTCGTGAGGGTAAAGCCTATGTGGATGATACCCCAAG
GGAGCAAATGCAAAAAGAAAGAATGGATGGAATAGAATCAAGGTGTAGGA
ACAATAGTGTTGAGGAGAATTTGAAATTATGGAAGGAGATGATTGCTGGT
TCAGAGAGGGGAACAATGTGTTGTGTTAGAGGGAAATTGGATATGCAGGA
TCCTAACCAGTCAGTTAGGGACCCAGTATATTACCGTTGCAATCAGACTC
CTGACCACAAGATTGGTGCTTAAAT
Genomic location of T0276  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1394 marker 1394
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)