SGN Marker T0291

SGN-M1396
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TOVCX95TH
Arabidopsis best BAC match: AL022604.1
Arabidopsis position: 4.1800000
Arabidopsis identities: 0.955
Best GenBank protein hit: AAB39510.1
Evalue: 2.5e-79
Identities: 0.928
Description: AP-1 Golgi-related complex component; clathrin coated vesicles; clathrin assembly protein [Camptotheca acuminata]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39822)
Chromosome
10
Position
30.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0291 was used as an overgo probe on plate 16 [well D7]

Plausible BAC Matches:   P177F14

 Non-Plausible BAC matches

P163M15,   P299J17,   P166L04,   P179G01,   P185H22,   P180E09,   P147E11,   P299K19,   P297N12,   P142N06,   P148L11

 Overgo Sequences

A sequence
GCACGTCTAATTGCTGCACAGGAT
B sequence
CAGCCTCAACCAAAGAATCCTGTG
AB sequence
GCACGTCTAATTGCTGCACAGGATTCTTTG
Marker sequence
GCACCAGATTAGCCGACAGGGAAAGGTGAGGCTAACCAAGTGGTATTCAC
CATATTCACAAAAAGAGAGAACCAAGGTAATCCGTGAATTAAGTGGTATG
ATTCTCACTCGAGGACCGAAGCTTTGCAATTTTGTCGAGTGGAGAGGATA
CAAAGTCGTTTATAAAAGATATGCAAGCCTGTATTTCTGTATGTGCATAG
ACCAAGAGGACAATGAGTTGGAGGTCCTGGAAATCATACACCATTTTGTT
GAGATTCTGGACCGATACTTTGGAAGTGTATGTGAGCTAGACTTAATTTT
CAATTTTCACAAGGCATACTATATATTGGACGAACTTGTGATTGCTGGTG
AACTCCAAGAATCAAGCAAGAAAACAGTTGCACGTCTAATTGCTGCACAG
GATTCTTTGGTTGAGGCTGCCAAAGAAGAGGCAAGTTCTCTTAGTAACAT
CATTGCACAGGCTACTAAATGAGAGTATGCAG
Genomic location of T0291  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1396 marker 1396
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)