SGN Marker TG503

SGN-M14

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CACTATACTAGTAATATATAATATGCAGTAGGTTATATTTGATTAATTATTTGTCTTTCACTTGTCTCTACACTTGGTGCTGAGTAGATG
TTTGAACTTCAAGTCAAAGCTATGCCATGAAGGCGATAATGGAACTAGTATGACTGAGTTAGTTGCTTAGCACCAGCTCAAAGTAGACCT
CCAAACAATCAACTCTGATTTTTTGATGATGTAAGGTGTTGCATAACTCGCATCAAGAAGATGCGAAATAGTACAAAAGAGGTTAGCGAA
CTCCAGTTACAAACAAAATACATTTACAGTCAGGGAGTTAACCAATAGAACCAAAAAGCCTATAGGTTGCGCAATCATGCCAAAGTAGAG
ATCTAATAAAATCTAGAAATGGGATAATATTATTAAGGGGAAAGATTGCTCCAACTATAAAGATTCCTAAGACATTTGGCTTTCAGGGAA
CTATTGGGAGTTGAAATACCATCAAAGCATTTCCAACTCGTTTCTGTCCAAATACACCAAAATATACATACTAGGATCATCTGCCTGA
Reverse sequence
TTCAAAAAGTAAAAGCTAGTCATTAATATATTGTCCATGAGAAGACTAATAGGCTTCAGAATGCCTAACCATGTCAAATCTAGGAAGTTC
ACTAAGGAAAAGGAGAAAAATGCTGAAAGTTGGGGAAATGAAGGAAAACAGTGTCAAACTTTCTTATTATTATGAGAGGAATTTAGTCAA
CAAAAAAGAAAAGAAACTATCTTCTCTAAATAGATGGCTAAACAGCTCCAGATTACACGGCCTAATTTTCAACTAAAACCCATAGCCATT
AGATGTCCTTTTAGTACCCATCTTATGATACTAAACATGTTGACCAGCTGCCTTGCTGACTATGGTAAGGGTCAACTTGAAAGTTCAATC
ATATCAGCACACATGGTAATTTGGTGTAATTCTATGATATCACGGGATGTACTTTTAAGAATCCAAAGCAAGTAACCATACCTAGGGATT
AACCATTTAACATTGTTGCATCAAGGCTCATGTATAGTTTAGGCAACAGCCGACTTGGTTTAGCTCTTGCTCTCCTTCTTTGGACCAGTG
TTTTAGGCAGCGAAAGGCGACAAGGGCCTGCCTCGCCTTGCGGCGCTCGCCTTCTTGATTTGCCCCAAAATCTAGTTCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1516314.4e-0528 (4.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53563)
Chromosome
5
Position
47.15 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7735)
Chromosome
5
Position
69.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7736)
Chromosome
5
Position
37.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG503 was used as an overgo probe on plate 5 [well G10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P249A23,   P168I17,   P269A16,   P080M07,   P053J02,   P048C24,   P254H09,   P068O01,   P070P13,   P196P19,   P278G23,   P018L02,   P141L24,   P117O11,   P052A04,   P148N20

 Overgo Sequences

A sequence
GACTGAGTTAGTTGCTTAGCACCA
B sequence
GAGGTCTACTTTGAGCTGGTGCTA
AB sequence
GACTGAGTTAGTTGCTTAGCACCAGCTCAA
Marker sequence
CACTATACTAGTAATATATAATATGCAGTAGGTTATATTTGATTAATTAT
TTGTCTTTCACTTGTCTCTACACTTGGTGCTGAGTAGATGTTTGAACTTC
AAGTCAAAGCTATGCCATGAAGGCGATAATGGAACTAGTATGACTGAGTT
AGTTGCTTAGCACCAGCTCAAAGTAGACCTCCAAACAATCAACTCTGATT
TTTTGATGATGTAAGGTGTTGCATAACTCGCATCAAGAAGATGCGAAATA
GTACAAAAGAGGTTAGCGAACTCCAGTTACAAACAAAATACATTTACAGT
CAGGGAGTTAACCAATAGAACCAAAAAGCCTATAGGTTGCGCAATCATGC
CAAAGTAGAGATCTAATAAAATCTAGAAATGGGATAATATTATTAAGGGG
AAAGATTGCTCCAACTATAAAGATTCCTAAGACATTTGGCTTTCAGGGAA
CTATTGGGAGTTGAAATACCATCAAAGCATTTCCAACTCGTTTCTGTCCA
AATACACCAAAATATACATACTAGGATCATCTGCCTGA
Genomic location of TG503  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14 marker 14
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)