SGN Marker TG460

SGN-M140

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CCTTAGTTTTGAAATCTTTAAGTAGCAATTAGTAATCGGTAGCTCTCCAGTATGAAAAGTTCATAATCACTTGGTGGATCTCTTATTATT
TGCATCATTTGTGTGCAATAGGCATAAGAGGTAGTCATTTCACAATGCCTCTGAAATGTGTGCATTGACATTTGAGAACACTTGAGGATG
GGATACACTCTCTGTCATCAGGAACTACTTAGGTGACAAATAGATGTGAAGATTCACGGCATAGTGTCTTTTGATCCATATCATAACCAG
AAAGTGAGTATCCCCATTTCTCACATTAGCTATATGAAGGAAGAAAGGGAAAACAAAGGAAAGCGCTACCCTTATTCGTCGAAAGCTAGC
CTTCATGATAAACCAAATGAAATTAGAAAAATTTAAGAACTTTGCTATAGCTTCAAAGAAATCTTTTAGATTCTTGTTTACAAAGTTTTG
CTGATCTTTCTTACAT
Reverse sequence
TTATGATGCTCAAAATTTCTTATTTTAGACAGACTCGAAATGTGACTATTCCAGAGAAAAATAAACAAGATCCCTCGGGACACTGAACCT
GAGAACAGGTTCAAATTCCCTACTGTACCCCAACAGACAAAGGGAAGAGAGAGCTATCAGTTTCTCTTTGGTTTGAGAAAAAACATAATA
GTATGGAGTGTACCAGATGCTTCAGGATTTCAGACATGTTCTGACTTGTTACCTAATGTATTTGATTTCATAGTATAAATCTTAGGTGTT
CTGCTTGACTAGAAGTATGGAAAGTCATTCTTGTCAGTAGTCAGTCTTGAGATATAAGATATAATTTGATATACATCTAAATAGATCTTG
GATTCATTAGATAAGTTCAACAAGCATGGGTCAATAAGCACATTGATCAATTACAGGATGTAGAATAACTTTGCTTATTGTGAAATCCTC
AAAAATGAATGATGCAGGCAAGAAGTGCAAATTACC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132219)
Chromosome
1
Position
87.73 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42467)
Chromosome
1
Position
93.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40050)
Chromosome
1
Position
70.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8276)
Chromosome
1
Position
98.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8278)
Chromosome
1
Position
109.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8277)
Chromosome
1
Position
60.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8282)
Chromosome
1
Position
98.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG460 was used as an overgo probe on plate 14 [well B7]

Plausible BAC Matches:   P193B10,   P079O04,   P198K04,   P120H17,   P234E03,   P259J18,   P145N03,   P208M24,   P016F06

 Non-Plausible BAC matches

P245I04,   P266F23,   P186M16

 Overgo Sequences

A sequence
TGAGAACACTTGAGGATGGGATAC
B sequence
CCTGATGACAGAGAGTGTATCCCA
AB sequence
TGAGAACACTTGAGGATGGGATACACTCTC
Marker sequence
CCTTAGTTTTGAAATCTTTAAGTAGCAATTAGTAATCGGTAGCTCTCCAG
TATGAAAAGTTCATAATCACTTGGTGGATCTCTTATTATTTGCATCATTT
GTGTGCAATAGGCATAAGAGGTAGTCATTTCACAATGCCTCTGAAATGTG
TGCATTGACATTTGAGAACACTTGAGGATGGGATACACTCTCTGTCATCA
GGAACTACTTAGGTGACAAATAGATGTGAAGATTCACGGCATAGTGTCTT
TTGATCCATATCATAACCAGAAAGTGAGTATCCCCATTTCTCACATTAGC
TATATGAAGGAAGAAAGGGAAAACAAAGGAAAGCGCTACCCTTATTCGTC
GAAAGCTAGCCTTCATGATAAACCAAATGAAATTAGAAAAATTTAAGAAC
TTTGCTATAGCTTCAAAGAAATCTTTTAGATTCTTGTTTACAAAGTTTTG
CTGATCTTTCTTACAT
Genomic location of TG460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D140 marker 140
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)