SGN Marker T0302

SGN-M1400
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVDQ59TH
Arabidopsis best BAC match: AC005405.1
Arabidopsis position: 5.0560000
Arabidopsis identities: 0.927
Best GenBank protein hit: AAC16238.1
Evalue: 1.4e-23
Identities: 0.363
Description: ubiquitin-conjugating enzyme homolog peroxin 4 [Pichia angusta]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39332)
Chromosome
11
Position
89.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13959
Forward primer (5'-3')
TGGCTCATCCTGAAGCTGATAGCGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTGTACATCCTTGCCATTGACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13959
Forward primer (5'-3')
TGGCTCATCCTGAAGCTGATAGCGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTGTACATCCTTGCCATTGACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 14152
Forward primer (5'-3')
TGGCTCATCCTGAAGCTGATAGCGC
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 200+600
Solanum pimpinellifolium LA1589: 300+600
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTGTACATCCTTGCCATTGACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 143
Forward primer (5'-3')
Unknown
Digested band sizes (using unknown)
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
T0302 was used as an overgo probe on plate 10 [well H6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P098C09,   P291E19,   P334H19,   P334K14

 Overgo Sequences

A sequence
GTGGAGTTTTCCAGCTCGCTTTCT
B sequence
TACTGCTCTGGAACTGAGAAAGCG
AB sequence
GTGGAGTTTTCCAGCTCGCTTTCTCAGTTC
Marker sequence
CGAGGCCTATATTTCCATCCAAAACTTAAAAGACTGCCACGGCGAATTTT
GATACTCATCGGAATCAGTGTCCGACGAACAAAAATACTAATTTCTCTTG
AAGATTTTCTGTAATTTCTGCAAAAAAGGTTCTTAAGCTTTGAAGTGTTG
ATTGTAGAGAAATCAATAAGGATGCAGGCTTCAAGGGCAAGACTTTTCAA
GGAGTACAAAGAAGTACAGAGAGAGAAAACAGCTGATCCTGATATTCAAT
TAGTTTGTGATGACTCTAATATCTTTAAATGGACGGCTCTTGTTAAAGGG
CCATCTGAAACTCCTTATGATGGTGGAGTTTTCCAGCTCGCTTTCTCAGT
TCCAGAGCAGTATCCATTGCAACCTCCTCAAGTGCGGTTCCTGACCAAAA
TATTTCACCCAAATGTTCATTTTAAGACCGGAGAGATTTGCCTTGATATT
TTGGAAAATGCATGGAGCCCAGCATGGACACTCCAGTCTGTTTGTCGAGC
TATAATTGCTTTGATGGCTCATCC
Genomic location of T0302  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1400 marker 1400
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)