SGN Marker T0360

SGN-M1418
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TOVAX58TH
Arabidopsis best BAC match: AL078637.1
Arabidopsis position: 4.1240000
Arabidopsis identities: 0.903
Best GenBank protein hit: AAA16785.1
Evalue: 1.6e-93
Identities: 0.915
Description: heat shock protein 90 [Catharanthus roseus]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49508)
Chromosome
4
Position
63.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47442)
Chromosome
4
Position
121.49 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39827)
Chromosome
4
Position
131.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0360 was used as an overgo probe on plate 7 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAGTAGATCCACCAAAGGTTGAG
B sequence
CAGCACCAAACTTCTCCTCAACCT
AB sequence
CCAGTAGATCCACCAAAGGTTGAGGAGAAG
Marker sequence
GCACCAGACCAGTAGATCCACCAAAGGTTGAGGAGAAGTTTGGTGCTGTT
CCTAATGGTTTATCGACTGATTCTGATGTGGCTAAGAGGGAAGCTGAGTC
TATGTCAAGGAAAACTCTCCGAGCTAGTGCGGAGAAGTTTGAGTTCCAGG
CTGAGGTCTCTCGTCTTATGGACATCCTTATCAACTCTCTCTACAGTAAC
AAGGACATCTTTTTGAGGGAGCTGATTTCCAATGCTTCTGATGCACTGGA
CAAGATTAGGTTCCTTGCACTCACTGACAAGGAGGTTCTTGGTGAGGGTG
ATAATACTAAGCTTGAGATTCAGATTAAACTTGATAAAGAAAAGAAAATT
CTTTCCATTCGCGACAGAGGTGTTGGAATGACCAAGGAGGATCTAAGAAA
GAATTTGGGAACCATAGCTAAATCTGGAACTTCAGCTTTTGTCGAGAAGA
TGCAGACAAGTGGTGACCTTAACCTGATTGGACAATTTGGTGTTGGGTTT
TACTCTGTGTATCTTGTGGCTGACTATGTTGAAGTCATCAGCAAGCACAA
TGACGACTAACAATATGTCTGGGAATC
Genomic location of T0360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1418 marker 1418
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)