SGN Marker T0368

SGN-M1421
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TSHAI70TH
Arabidopsis best BAC match: AL035522.1
Arabidopsis position: 4.1790000
Arabidopsis identities: 0.776
Best GenBank protein hit: CAB80221.1
Evalue: 7.0e-56
Identities: 0.670
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39337)
Chromosome
1
Position
165.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0368 was used as an overgo probe on plate 3 [well D4]

Plausible BAC Matches:   P216F22

 Overgo Sequences

A sequence
GAAGCTGTTCGCAAGTATCGTGAG
B sequence
CCCGAGCCTTCTTTTTCTCACGAT
AB sequence
GAAGCTGTTCGCAAGTATCGTGAGAAAAAG
Marker sequence
GGCACGAGGAATTTAGTAGTTCAATGGACAGTTTTTTCAATGAGATTCTC
AAGGATGCGCATGCCTGTACTCATGCCCACACTTGTAACCCGCCTGGTCC
TGATAACTCTCATACTCACACTTGTTACCATGTTCACACCAAAATAGTTC
CTACAACAGATGACGATAAGAACCCCAGTGATGATACTGCAGAGTCTGCA
GAGAATAAAGGAAAGAAACGCCCGGTGGGTAATAAGGAAGCTGTTCGCAA
GTATCGTGAGAAAAAGAAGGCTCGGGCTGCTTCATTAGAGGATGAAGTTG
TCAGATTGAGGGCTATAAACCAGCAACTCTTGAAGAGGCTGCAAGGTCAG
GCTGTATTGGAAGCGGAGGTTGCTAGGCTCAAGTGTATGCTTGTGGATAT
ACGTGGAAGGATTGAAGGGGAAATTGGATCATTTCCATATCAGAAGCCCA
TGAAGAGTGGCAATACATATCAGCACATAGTTAATCCTAACTTTCCTGGT
GCATATGTGGCGAACTCTTGCAACCTACAATGAGATGATCACGTTTATTG
CC
Genomic location of T0368  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1421 marker 1421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)