SGN Marker T0408

SGN-M1426
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TOVCK77TH
Arabidopsis best BAC match: AC006551.6
Arabidopsis position: 1.0470000
Arabidopsis identities: 0.904
Best GenBank protein hit: CAA79855.1
Evalue: 5.5e-97
Identities: 1.000
Description: phospho-2-dehydro-3-deoxyheptonate aldolase [Lycopersicon esculentum]
Comment: shikimate pathway: phenylalanine and tyrosine biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49511)
Chromosome
11
Position
3.20 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47445)
Chromosome
11
Position
40.21 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42375)
Chromosome
11
Position
19.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41616)
Chromosome
12
Position
17.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43584
Forward primer (5'-3')
GCTGCTGGACTCACAGTTGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTCGGCACCCATTCTAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39342)
Chromosome
11
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10533)
Chromosome
11
Position
18.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0408 was used as an overgo probe on plate 10 [well A6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGAACAGGGAGATAGGTATCAGG
B sequence
ACCCTGTGAGCTAGTTCCTGATAC
AB sequence
GTGAACAGGGAGATAGGTATCAGGAACTAG
Marker sequence
CTTGATTTTGTGGAGAACAGTGAACAGGGAGATAGGTATCAGGAACTAGC
TCACAGGGTTGATGAAGCCTTAGGATTCATGGCTGCTGCTGGACTCACAG
TTGACCACCCTATCATGTCAACAACTGATTTCTGGACATCCCATGAGTGC
TTGCTTCTTCCTTATGAACAAGCACTTACAAGAGAGGATTCAACTTCTGG
TCTTTTCTACGATTGTTCTGCTCACATGGTTTGGGTTGGGGAAAGAACCA
GGCAACTAGACGGTGCTCATGTCGAGTTTTTGAGAGGAGTTGCGAACCCT
CTTGGAATAAAGGTGAGTCAAAAAATGGATCCAAAAGAGCTAATTAAGCT
CATTGACATCCTGAACCCTGCCAATAAGCCTGGAAGAATTACTGTAATTG
TTAGAATGGGTGCCGAGAACATGAGAGTAAAACTTTCCCACTTGGTCAGG
GCTGTACGGGGCGCTGGTCAGATTGTGACATGGGTTTGTGATCCAATGCA
CGGGAATACCATCAAGGC
Genomic location of T0408  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1426 marker 1426
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)