SGN Marker TG178

SGN-M143

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1630
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG178 image not available
Forward sequence
AATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGCCATCAATCATCATGCCTGCACTTGTTGTAACTGAAGAAACAATG
GCCTCCGAGCTATCCAAGAAAAAAATGAAGAAGACATCCCAAACAGATATTGAAACTCCTACTGATAAGAAAACCAAAGAGAAAAAGTCA
AAAAAATCCAAGATTGAGTCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAGAAAGAGAAAAAGAGAAAAGCTTTGGACTTGGAT
GGTGAGAAGAGTGATACGAGCTCAGAGATATGTGAGCCCGTAGATTTGAAGAAGAATAAAAAGGCTAAATTCGACGACGAACAAGTGATG
GTTGAGAAGAAAGTCGAGGATCCTAATGCTTTGTCTAATTTTAGGATTTCAAAGCCTTTAAAAGAGGCTTTGAATTCTAAGGGAATAGAA
GCACTTTTTCCTATTCA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1432501.3e-75222 (47.5% of RFLP seq)+
SGN-U1432581.3e-75222 (47.5% of RFLP seq)+
SGN-U1432582e-114211 (45.2% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50353)
Chromosome
6
Position
21.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48288)
Chromosome
6
Position
11.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42413)
Chromosome
6
Position
42.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39926)
Chromosome
6
Position
10.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8289)
Chromosome
6
Position
10.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8291)
Chromosome
6
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8290)
Chromosome
6
Position
8.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8295)
Chromosome
6
Position
6.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG178 was used as an overgo probe on plate 2 [well G8]

Plausible BAC Matches:   P192K10,   P271L05,   P178C12,   P115H12,   P003K02

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCTTTGGACTTGGATGGTGAGAAG
B sequence
CTGAGCTCGTATCACTCTTCTCAC
AB sequence
GCTTTGGACTTGGATGGTGAGAAGAGTGAT
Marker sequence
AATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGCCATC
AATCATCATGCCTGCACTTGTTGTAACTGAAGAAACAATGGCCTCCGAGC
TATCCAAGAAAAAAATGAAGAAGACATCCCAAACAGATATTGAAACTCCT
ACTGATAAGAAAACCAAAGAGAAAAAGTCAAAAAAATCCAAGATTGAGTC
TGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAGAAAGAGAAAAAGA
GAAAAGCTTTGGACTTGGATGGTGAGAAGAGTGATACGAGCTCAGAGATA
TGTGAGCCCGTAGATTTGAAGAAGAATAAAAAGGCTAAATTCGACGACGA
ACAAGTGATGGTTGAGAAGAAAGTCGAGGATCCTAATGCTTTGTCTAATT
TTAGGATTTCAAAGCCTTTAAAAGAGGCTTTGAATTCTAAGGGAATAGAA
GCACTTTTTCCTATTCA
Genomic location of TG178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D143 marker 143
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)