SGN Marker T0482

SGN-M1439
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TCAAZ08TH
Arabidopsis best BAC match: AB017063.1
Arabidopsis position: 5.1950000
Arabidopsis identities: 0.772
Best GenBank protein hit: BAB08750.1
Evalue: 1.8e-45
Identities: 0.575
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49513)
Chromosome
3
Position
61.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47447)
Chromosome
3
Position
104.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39346)
Chromosome
3
Position
137.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0482 was used as an overgo probe on plate 2 [well G6]

Plausible BAC Matches:   P034B23

 Overgo Sequences

A sequence
AGCATCTGTTGCAACCTCCACACT
B sequence
GAGATTGTGAGACTGGAGTGTGGA
AB sequence
AGCATCTGTTGCAACCTCCACACTCCAGTC
Marker sequence
GAAGAAATGGCGAATTTGCGAAGGGCACTTCTCTTCACCATTCCTCGAAT
CATCAATTCCTCTAAAACAGCATCTGTTGCAACCTCCACACTCCAGTCTC
ACAATCTCTACAGGCCTTTAGCTGGAACATTTTCGCGTTTTATTTCTTCT
AATGAGACTTCATCGCCGATGAATATCGATCTTTCCGACGAAGAGAGCAA
AAGACGTTTGTTTAACAGGCTTATTTATCGTAGTAAACAGAGAGGTTACC
TGGAGCTAGACCTTGTTCTTGGAAAATGGGTGGAGGAACATATACAATCC
ATGGATGAAAATGGAATTAAGTCCCTTGTTCATGTCCTTGACCTGGAGAA
TCCAGATTTGTGGAAGTGGCTGACTGGTCAGGAGCAACCCCCAGATGCAA
TAAGCACAAATCCTGTGTTTTCTGCTGTGCATGAAAAGGTTATGAACAAC
CTTAACAATCATACTTCTCCCGAGACT
Genomic location of T0482  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1439 marker 1439
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)