SGN Marker T0506

SGN-M1448
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TCABD41TH
Arabidopsis best BAC match: AC004077.2
Arabidopsis position: 2.1910000
Arabidopsis identities: 0.944
Best GenBank protein hit: AAC26685.1
Evalue: 9.1e-66
Identities: 0.801
Description: putative pyruvate dehydrogenase E1 beta subunit (Arabidopsis thaliniana)/3rd pyruvate dehydrogenase E1 beta subunit A.thaliana
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49515)
Chromosome
4
Position
2.20 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47449)
Chromosome
4
Position
13.96 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39350)
Chromosome
4
Position
17.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0506 was used as an overgo probe on plate 6 [well G12]

Plausible BAC Matches:   P156K11,   P036I24,   P158D06,   P228J04,   P261I22,   P224I11,   P038M05,   P319C03,   P039C03,   P157A17,   P237I13,   P030B23,   P008E01,   P250K16,   P266O02,   P251H14,   P077H05,   P267O02,   P190K14,   P168N14,   P029G22,   P243C06,   P063H12,   P223D21,   P184B22

 Overgo Sequences

A sequence
GTCGGTCATTATGGAGGTTCGTAC
B sequence
GGCCTTTAGTCACCTTGTACGAAC
AB sequence
GTCGGTCATTATGGAGGTTCGTACAAGGTG
Marker sequence
GTTGGTGCAGAGAGGAAAGGAAGGACTTTTGTGGTTAGATCTGATGGGGG
TTTGAGCTATGGTTTGAATGGACGTGGAGGAAGAGCTGAACAATTAATTA
CTAATGCTGTTGCTACTAAAGAAGATACTGCTGCAGCTTCTACTTCATCA
AAGCCAGGGCATGAACTATTGCTCTTTGAGGCCCTCCGTGAAGGTCTTGA
AGAAGAAATGGACAGGGATCCCGCTGTTTGTGTAATGGGTGAAGATGTCG
GTCATTATGGAGGTTCGTACAAGGTGACTAAAGGCCTTGCCCCAAAATAT
GGTGATCTCAGGGTTCTTGACACTCCCATTGCTGAGAACTCTTTCACTGG
TATGGGCATTGGAGCTGCAATGACCGGTTTGCGTCCAGTTATTGAGGGAA
TGAACATGGGATTTCTTCTTCTAGCCTTTAATCAAATATCTAACAACTGC
GGTATGCTCCACTACACATCTGGTGGCCAGTTTAAGATACCAGTCGTCAT
CCGAGGTCCTGGTGGAGTTGGTCGACAGCTTGGA
Genomic location of T0506  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1448 marker 1448
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)