SGN Marker T0518

SGN-M1452
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TCABH65TH
Arabidopsis best BAC match: AC007020.4
Arabidopsis position: 2.2190000
Arabidopsis identities: 0.586
Best GenBank protein hit: AAD25679.1
Evalue: 2.7e-29
Identities: 0.508
Description: putative WD-40 repeat protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39832)
Chromosome
3
Position
94.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0518 was used as an overgo probe on plate 6 [well D7]

Plausible BAC Matches:   P180N02,   P099G11,   P333O13

 Overgo Sequences

A sequence
GAAGGGCGACTATTTCTCAACGCT
B sequence
TTGGGCAGATGGCATAAGCGTTGA
AB sequence
GAAGGGCGACTATTTCTCAACGCTTATGCC
Marker sequence
CAGGAGAAGATGTATATCTTCTGAATACTGGACTTGGCAACGCAGAAGAA
CAAAAGAGTCTTGAAGAGCTTTTGCATGTTGAAACTCCATCAACCCCTGA
TGACTCTGATAATGATAAAATCGCTGTGAATTGGGTTCAAGATGATAAGA
ATGGGGGAATCAGGTTGAAGCACTTCAAGACTGTTTCTTCAGTTGAGTGG
CATCGGAAGGGCGACTATTTCTCAACGCTTATGCCATCTGCCCAATCAAA
AGCAGTGCTAATTCATATGCTCTCAAAGAAACAGACTCAAAGAATACCAT
TCAAGCTTCATGGACTTCCAGTTTCAACAGCTTTCCATCCCTCTCGCT
Genomic location of T0518  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1452 marker 1452
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)