SGN Marker T0522

SGN-M1454
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TCABG78TH
Arabidopsis best BAC match: AC009606.2
Arabidopsis position: 3.0100000
Arabidopsis identities: 0.600
Best GenBank protein hit: AAF64533.1
Evalue: 2.8e-33
Identities: 0.527
Description: "stress related protein, putative [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39354)
Chromosome
3
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0522 was used as an overgo probe on plate 8 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAAAGTGCTGGTGTGATGGGAGC
B sequence
AGCAAGTCCTGATGCAGCTCCCAT
AB sequence
CAAAAGTGCTGGTGTGATGGGAGCTGCATC
Marker sequence
GTAGGTTGATCAGTCTGTTCGTACGATTGAAACTCGTGTCCCCCCTATGG
TCAAGCAAGCTCCTGCAGCTGCTCGCTCTGTTGCAGCTGATGTCAAAAGT
GCTGGTGTGATGGGAGCTGCATCAGGACTTGCTAAAACAGTCTATGCCAA
GTATGAGCCCACCGCTAAGGGACTTTACACCAAATACGAGCCAATGGCCG
AGCAGTATGCTGCATCAGCTTGGCTCTCTCTCAACAAATTTCCCATTGTT
CCTAAAGTTACTCAAGCGGTTGTTCCAACAGCTGCTTACTATTCCGAGAA
ATACAATGTGATGGTTCAGCAAACAGCAGAGAAGGGATACAAGGTTGCTT
CATATCTTCCATTGGTACCTACAGAGAAGATTGCTAAGGTGTTCAGTACT
CAGCCTGTGGCTTCCAGCTAAGAAGGACCTACTGGTTTACTTAATGATTC
ACAAGTAGCAAGTTAGTTCTATGTGAGGTTCTTTATATGA
Genomic location of T0522  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1454 marker 1454
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)