SGN Marker T0525

SGN-M1457
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TCABG93TH
Arabidopsis best BAC match: AB026636.1
Arabidopsis position: 3.0410000
Arabidopsis identities: 0.694
Best GenBank protein hit: BAA94980.1
Evalue: 3.2e-45
Identities: 0.633
Description: similar to unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42391)
Chromosome
1
Position
56.60 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39355)
Chromosome
1
Position
31.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10586)
Chromosome
1
Position
57.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0525 was used as an overgo probe on plate 9 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTAGCAGTCGATTTCTCAGCTTG
B sequence
CAGAGCTTTGTTGCTGCAAGCTGA
AB sequence
GGTAGCAGTCGATTTCTCAGCTTGCAGCAA
Marker sequence
CAAGAAACTGTTTAACCAAGCAAAAATCTTGGAGTTGTAGGTATGGAAGG
AGGTGGTAGATTTGTTGGGGTAGCAGTCGATTTCTCAGCTTGCAGCAACA
AAGCTCTGAAATGGGCCATTGATAATATTCTTCGTAAAGGGGATCATCTT
ATTCTCGTCACTGTTCGTCCTGAAGGACACTATGAAGAAGGAGAGATGCA
GCTCTGGGAGGCCACTGGTTCTCCTTTAATACCTTTATCAGAGATATGTG
ATGGCCACACAATGAAGAGGTATGGGGTTAACCCTGACCCTGAAACATTG
CAAATGATAACCCTTGCAGCTAGGCAGATGGAGATCACAGTAGTCATGAA
AATTTTCTGGGGAGATGCTCGAGAGAAGTTATGTGAAGCAATTGATAAAA
CTCCCTTGAGCTGTCTGGTCATAGGGAACAGAGGGCTTGG
Genomic location of T0525  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1457 marker 1457
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)