SGN Marker TES718

SGN-M14651

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49988)
Chromosome
10
Position
64.37 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47923)
Chromosome
10
Position
83.60 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45573
Forward primer (5'-3')
GTGGTGTACCAGCAAGATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAATTACAAGCCTGGAGCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES718  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14651 marker 14651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)