SGN Marker T0567

SGN-M1476
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.22
Tomato EST read: TMEAC13TH
Arabidopsis best BAC match: AC005679.1
Arabidopsis position: 1.1498000
Arabidopsis identities: 0.820
Best GenBank protein hit: AAA33139.1
Evalue: 1.6e-62
Identities: 0.958
Description: vacular H+-ATPase [Daucus carota]
Comment: transport of metabolites into vacuole
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39362)
Chromosome
1
Position
94.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39363)
Chromosome
12
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0567 was used as an overgo probe on plate 5 [well B3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATCCAGCTGAAGGAGAGGATGTTC
B sequence
TGAAACTTGCCCACCAGAACATCC
AB sequence
ATCCAGCTGAAGGAGAGGATGTTCTGGTGG
Marker sequence
GCTGAAACAGATAAGATTACCTTGGAAACTGCAAAACTTTTAAGGGAGGA
CTACCTTGCACAAAATGCTTTTACGCCATATGATAAGTTCTGCCCTTTCT
ACAAATCTGTTTGGATGTTGCGCAACATCATCCACTTCTATAACTTGGCC
AACCAGGCCGTTGAGCGAGGAGCTGGTATGGATGGACAAAAAATCACTTA
CACTCTCATTAAGCACCGTCTAGGAGATTTGTTCTACCGTTTGGTGTCCC
AAAAGTTTGAGGATCCAGCTGAAGGAGAGGATGTTCTGGTGGGCAAGTTT
CAGAAGCTTCATGATGATTTGGTTGCTGGTTTCCGCAACCTTGAGGATGA
GACTCGATAATCGCGATTTGCTGAAATGTGCAGTTTTGTAGGGATCGACC
AAATTCTCGAGAAGCAAATAATTCCGTGGTCTTCTACAATGTAAGAACAC
ATCAAATCAGTTGTGTGCAGTTTTCCACAATGGTCGTCTGGATCCATGAA
AATTAAAATGGAAAAAAAAAGAATTGTGTGTTTCCTCAGTAGTCTTTTGT
ATGGTTGCTGTATCTCTTTTTTATCCAATAGCATGGCGCATGACCGGGTC
ATTTAGGTAATGTTATCTTTAGTTTTGAGTTTATCATGAGATTTGAAGAA
TAAAGCTGCGATTGTGAATTTATACCTAAGCTATATTACTTGGGTACAA
Genomic location of T0567  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1476 marker 1476
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)