Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker TES1141

SGN-M14771

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50108)
Chromosome
4
Position
4.96 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48042)
Chromosome
4
Position
29.57 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45092
Forward primer (5'-3')
GTCCAATTACACAACCAGACCA
Accessions and product sizes
Solanum lycopersicum LA925
229
Solanum pennellii LA716
232
Approximate temperature
55°C
Reverse primer (5'-3')
ATGAATCCCATTTCACCCAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1141  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14771 marker 14771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)