SGN Marker TG537

SGN-M148

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATAACAAAAAATAAAGTTATAAAATTAAGAAAAAATTAAAATAGCCATGTAGTTAATTAACTGATTTTTAATTTTTTTGAACTTACTCT
AAGTTCTTCAAGAACTTTTGGATGATCATGAAGATATTTCACAGCCATCATAGAAGTGGTGGAAACAGTTTCATATCCAGAGTACAAAAT
AGTTATAATTAAATCAATCATCTCATCATCTGTTAATTTGAATCGTGTTGCTTCCTCATTCATCAGGTAACCAAGCATATCATGTTGAAT
TTCCTTTGAAGCTCTTCTCTCTTCTATGAGTGTTCGTAATAAGTTCACAATAATTTTCCTTGCCTGAAAAATATTTTTCCTAGATTATTA
GATGCTCTCAGATAACATCATAAATAACAGTATTCTGAAATTCTACCTGAAATCCGCGATGATAGTTGGTGTTTGGAAGATTGATAGGGT
AGTGAAAGAG
Reverse sequence
TAAAAGACATTGCTATTTATGAAGTTTTTGTTACCCGAGGCTCAGAAACACTGACCTTTTTCCTTTGTAGGGCGTGGGGTTTTAACGTAT
TAGGCCACCTCCCTACCACAAATCCCTCTATATTTCTTTTTTAAATCTATCTATTCATATAAATCAATTGTTTCGATTAATCAAGATTTA
TATTATTTGATATTTGAAAATAATCAATATTAGTATCATTTAATATTTGAAAATTACTAATTTCATTAGATTTTTGGCAAAATAAGCCAG
ATAAAATCTTCATTTCCATTTTAACAATTAGACTGATTCAAGTTTATATCGAATAAATAAAATATAACTATATTAAATTATGTATTTAAA
AATTTAAATCACAAAACTTTTGATTAAAGATCACAGAAAAAAAAAACCCATCGAACCACAAGGTTAGTGGTCCCTGTGTCCTTTTTAAGT
GGGAAAAAAACCCATCTCCTGTTGATGTAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43877)
Chromosome
2
Position
34.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43616)
Chromosome
2
Position
79.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43339)
Chromosome
2
Position
89.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42485)
Chromosome
2
Position
95.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40883)
Chromosome
2
Position
85.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Eggplant-LXM 2002   
Map version
29 (location: 8310)
Chromosome
2
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8309)
Chromosome
2
Position
86.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG537 was used as an overgo probe on plate 16 [well D12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCGCGATGATAGTTGGTGTTTGG
B sequence
CTACCCTATCAATCTTCCAAACAC
AB sequence
TCCGCGATGATAGTTGGTGTTTGGAAGATT
Marker sequence
AATAACAAAAAATAAAGTTATAAAATTAAGAAAAAATTAAAATAGCCATG
TAGTTAATTAACTGATTTTTAATTTTTTTGAACTTACTCTAAGTTCTTCA
AGAACTTTTGGATGATCATGAAGATATTTCACAGCCATCATAGAAGTGGT
GGAAACAGTTTCATATCCAGAGTACAAAATAGTTATAATTAAATCAATCA
TCTCATCATCTGTTAATTTGAATCGTGTTGCTTCCTCATTCATCAGGTAA
CCAAGCATATCATGTTGAATTTCCTTTGAAGCTCTTCTCTCTTCTATGAG
TGTTCGTAATAAGTTCACAATAATTTTCCTTGCCTGAAAAATATTTTTCC
TAGATTATTAGATGCTCTCAGATAACATCATAAATAACAGTATTCTGAAA
TTCTACCTGAAATCCGCGATGATAGTTGGTGTTTGGAAGATTGATAGGGT
AGTGAAAGAG
Genomic location of TG537  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D148 marker 148
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)