SGN Marker T0577

SGN-M1482
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.07
Tomato EST read: TMEAA34THB
Arabidopsis best BAC match: AB010073.1
Arabidopsis position: 5.2640000
Arabidopsis identities: 0.918
Best GenBank protein hit: CAA90426.1
Evalue: 7.2e-89
Identities: 0.970
Description: pentose-5-phosphate-3-epimerase [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49522)
Chromosome
3
Position
59.47 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47456)
Chromosome
3
Position
87.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39366)
Chromosome
3
Position
120.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0577 was used as an overgo probe on plate 2 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAGGAGGAGAATTCAAACTGTGG
B sequence
CGAGAAGAAGCTGTCACCACAGTT
AB sequence
CCAGGAGGAGAATTCAAACTGTGGTGACAG
Marker sequence
TTTTGAGCTTTGGTGCTTTCAAATTGACAAAGTACCAACCTTTATTCTCA
ATTTTCAACAAGGCAAAAGTTTGCTTCAAGAAAATTTTAAAAAAAAACAA
TCAATGGCGACTGCTTCTTCTTTGGGTTCATCAACTCTGTTACAATCCCA
AATTAGTGGATTTGGCGGGAGTCAAAAGATTTCTTTCTCCAACCCCAATT
CACTCACTTTCACCAGGAGGAGAATTCAAACTGTGGTGACAGCTTCTTCT
CGGGTGGATAAGTTCTCGAAAAGCGACATTATTGTTTCTCCATCCATCCT
TTCTGCTAACTTTTCTAAATTAGGAGAGCAGGTGAAAGCAGTTGAGCAGG
CAGGCTGCGACTGGATTCATGTAGATGTGATGGATGGTCGATTTGTTCCA
AATATAACTATTGGACCCCTTGTAGTTGATTCCTTGCGCCCTATCACAGA
TCTTCCACTGGATGTGCATCTGATGATTGTCGAACCTGACCAGAGAGTAC
CTGACTTCATAAAAGCAGGTGCTGATATTGTCAGTGTTCATTGTGAGCAA
TCTTCTACAATCCACTTGCATCGTACAATAAACCAGATTAAAAGTTTGGG
AGCTAAAGCTGGGGTTGTCCTCAATCCTGGAACCCCTTTAACCGCAATTG
AATATGTCCTTGATGCTG
Genomic location of T0577  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1482 marker 1482
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)