SGN Marker T0581

SGN-M1484
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAD34TH
Arabidopsis best BAC match: AB017063.1
Arabidopsis position: 5.1950000
Arabidopsis identities: 0.644
Best GenBank protein hit: BAB08747.1
Evalue: 3.8e-42
Identities: 0.745
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49523)
Chromosome
3
Position
61.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47457)
Chromosome
3
Position
104.27 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40811)
Chromosome
3
Position
103.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39367)
Chromosome
3
Position
137.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0581 was used as an overgo probe on plate 2 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGCCCTGAATCTTCTTTTTGGAGC
B sequence
TTGCCCAGTATGTGGAGCTCCAAA
AB sequence
CGCCCTGAATCTTCTTTTTGGAGCTCCACA
Marker sequence
CCATCACTATAGAAGTGGAATATATAGAATGAATGGATAGAATAAACAAT
TATACATAGAAGAACTCCAATACAAAATTTAACAATCTCCTTGATGTGTT
AAACAGAAGATGATGACATTGTTATTGGGTCCACTTGAATCTAGGAAGTG
TTGTTGACATAGAAGTATAAAGCATCAAGTGCAACAACTCCAACTCCAAT
AGCAATAGGCAGTATGTTCCCAACAGCCTCATCTCTCTTTAACTGTTCTT
TCCGGGCCTTACAAACATCAGTCGAATTAGCATCTTTGGTTACTTTAGGT
TCATACGCCCTGAATCTTCTTTTTGGAGCTCCACATACTGGGCAAAAGTA
TTTGTCAGGTAATTTCTCAAAAGGAGTTTTGTCATTGTAAATATACCCGC
AATCCCGGCAAATATAGGCTTGCTTGGAGGTAACGCGCATGGAGATTTTC
GGGGCAGTAGCAGGAGCTGCTCTAGAGAATGATGGAGGAGGGAGCAAGAT
ATGAATTGATGGAG
Genomic location of T0581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1484 marker 1484
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)