SGN Marker TG464

SGN-M149

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG464 image not available
Forward sequence
AGAAGCTGATAGTGAAACACACCACAGTTACAGATAGTTATGAAAAGAAGTCTGGTGGTCGAGATATTGAGAACCGTATTGCACCAATCC
AGCAAAGAATTAGAGCTTTGAGACAGGAAATTGATGATCTTCTGGAAATAATTGATGAGATATAATTTCAGTGCAGACAACATTGATCCA
ATATAAATGGCTAAAATATTGTTGTGAGGTGAACAACAGAATTAGGATCAATTCGAGATATTAGTTGATGCAGCTGTATGTTGTTGAGAA
CCTGAATAACTTTGTAGTTGTAGAATTCTAGGTTCTTGCCGAATCTCTTTGGTTGACAATCAAATGAGTGCTGTAGACAACTGTTTTTTC
ATATATATTGAGTTGTTAAGTTTATGGTTTTCTAACGTAATTGAGCTCAAAGATTATCAAATTCCGACTTGATATTGCAAGTGA
Reverse sequence
AAGAACAAGTCTCTATCGTGCAAAAACTTCAAGAAGAATAACTCAGTGATGCTCAAATCACTAGTCTTTTAACATGAGTAAACAGTTAAA
CTAAATCATCTAGACATCATGAACCAGCAGAAAACATACCCAAAAACCCCACATGACATTTACAAAAGAAGTTTCAGGGTGAGGGGTAAT
AATTGAGGTTGTGGAGAGGAAACAAGAGTATATCAAGCAAAAAATTCAAGAAGAACAACGAATGCTGAAAACCGAGTCTCTTGGCATGGA
TAAATGCATAAAGCTCAAGTCTTGTCACAAAATTTCAAGGAAAGGGCAACTTATTAATGCTCAAAACTGAATCTTTTGACATGGGCAAAT
TCTTACAGCTCAAGTCTTGTCACAAAATTTCATGGAAAGAGCAACTTATTAATGCTCAAAACTGAATATTTTGACATGGGAAATGCTTAA
AACTCAAGTCTCCTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146142395 (89.0% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53332)
Chromosome
4
Position
79.98 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50394)
Chromosome
4
Position
50.37 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48328)
Chromosome
4
Position
126.29 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40052)
Chromosome
4
Position
135.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8311)
Chromosome
4
Position
101.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8312)
Chromosome
4
Position
124.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG464 was used as an overgo probe on plate 9 [well B11]

Plausible BAC Matches:   P230N17,   P319I18,   P289E21,   P134K17,   P182M15,   P325C21,   P052C16,   P105G01,   P013F10

 Non-Plausible BAC matches

P095G08,   P138D01,   P138B21,   P106H12,   P206I09,   P151C18,   P147J08,   P209D01,   P155I16

 Overgo Sequences

A sequence
GGTGGTCGAGATATTGAGAACCGT
B sequence
GCTGGATTGGTGCAATACGGTTCT
AB sequence
GGTGGTCGAGATATTGAGAACCGTATTGCA
Marker sequence
AGAAGCTGATAGTGAAACACACCACAGTTACAGATAGTTATGAAAAGAAG
TCTGGTGGTCGAGATATTGAGAACCGTATTGCACCAATCCAGCAAAGAAT
TAGAGCTTTGAGACAGGAAATTGATGATCTTCTGGAAATAATTGATGAGA
TATAATTTCAGTGCAGACAACATTGATCCAATATAAATGGCTAAAATATT
GTTGTGAGGTGAACAACAGAATTAGGATCAATTCGAGATATTAGTTGATG
CAGCTGTATGTTGTTGAGAACCTGAATAACTTTGTAGTTGTAGAATTCTA
GGTTCTTGCCGAATCTCTTTGGTTGACAATCAAATGAGTGCTGTAGACAA
CTGTTTTTTCATATATATTGAGTTGTTAAGTTTATGGTTTTCTAACGTAA
TTGAGCTCAAAGATTATCAAATTCCGACTTGATATTGCAAGTGA
Genomic location of TG464  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D149 marker 149
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)