Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TES1714

SGN-M14922

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50259)
Chromosome
3
Position
60.98 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48193)
Chromosome
3
Position
102.98 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45270
Forward primer (5'-3')
GCGTGTTCTTCTCCGCTTTCT
Accessions and product sizes
Solanum pennellii LA716
201
Solanum lycopersicum LA925
192
Approximate temperature
55°C
Reverse primer (5'-3')
ATCCCAAAAAGGGTCGAACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1714  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14922 marker 14922
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)