SGN Marker TES1740

SGN-M14929

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50266)
Chromosome
10
Position
2.53 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48200)
Chromosome
10
Position
20.12 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45279
Forward primer (5'-3')
GTTCTTTGTTGTTTGGGGCTT
Accessions and product sizes
Solanum lycopersicum LA925
131
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCAATCAAAATACATAAACAAAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14929 marker 14929
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)