Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TES1741

SGN-M14930

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50267)
Chromosome
4
Position
2.28 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48201)
Chromosome
4
Position
12.77 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45280
Forward primer (5'-3')
AAGAGGATAAAGAACAAAGGGGA
Accessions and product sizes
Solanum lycopersicum LA925
257
Solanum pennellii LA716
261
Approximate temperature
55°C
Reverse primer (5'-3')
GTTGTTTCCGATGGACCCTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1741  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14930 marker 14930
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)