SGN Marker TES1806

SGN-M14951

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48222)
Chromosome
3
Position
54.14 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45306
Forward primer (5'-3')
GAGCTTCTGGGGCTTCTCTT
Accessions and product sizes
Solanum pennellii LA716
371
Solanum lycopersicum LA925
369
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTGCTTTACAGCCTCTGCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1806  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14951 marker 14951
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)