SGN Marker T0612

SGN-M1497
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.03
Tomato EST read: TMEAA88TV
Arabidopsis best BAC match: AL161831.1
Arabidopsis position: 4.0610000
Arabidopsis identities: 0.703
Best GenBank protein hit: CAA45153.1
Evalue: 4.1e-70
Identities: 0.965
Description: chloroplast ATP synthase (delta subunit)[Nicotiana tabacum]
Comment: ATP production in chloroplast
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39373)
Chromosome
12
Position
72.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0612 was used as an overgo probe on plate 4 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGCTCCTGTTAATCGTTGAACTC
B sequence
GCACAGATCGCAAAAGGAGTTCAA
AB sequence
TCGCTCCTGTTAATCGTTGAACTCCTTTTG
Marker sequence
GTTTTACGCAAAATTATATATTACAAAAATATCATAATAATTAAAAAAAA
ACACAACAATTAATTATTTATACAGCTAGTTGAATATCCCCAATTTCAAG
CTGTGCAGCAATATCTTCAAGTTGTTTCTTCACACTCATATCAATCAATT
TAGATCCTGAATTTCCATACCTTATTGTAAATCCAGCAACAAGAGATTCA
TCAATCACTGTTTTGATCCTCACATTTTTCGCTCCTGTTAATCGTTGAAC
TCCTTTTGCGATCTGTGCTAAATGTTGCGATTCCAGTTTCACCACTGAAG
TCACTACAGCAAGTTCAGTATCCGTCAAGGTATTGTAAACTTTCTCAAAC
TCTTTAACAATGTCTTTGATTAATTCAACTCTCTTCATATCAACAAGGAT
GTTGAGAAAATTTGCAACGTGTGGTTGAATGCCTGTAGATGAAACGATCT
CGTCGACGAGTTCACGTTTTTTCTCTTCGCTAACGATAGGACTTACGAAG
AAAT
Genomic location of T0612  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1497 marker 1497
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)