Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TES1889

SGN-M14972

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50308)
Chromosome
12
Position
1.81 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48243)
Chromosome
12
Position
30.51 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45330
Forward primer (5'-3')
GAAAGAGGTAAAATCGCGGGT
Accessions and product sizes
Solanum pennellii LA716
209
Solanum lycopersicum LA925
200
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTTACGATTTCGCCTACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1889  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14972 marker 14972
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)