SGN Marker T0613

SGN-M1498
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAA91TV
Arabidopsis best BAC match: AC002561.2
Arabidopsis position: 2.2290000
Arabidopsis identities: 0.861
Best GenBank protein hit: AAB88647.1
Evalue: 1.2e-38
Identities: 0.796
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39374)
Chromosome
3
Position
74.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0613 was used as an overgo probe on plate 7 [well G8]

Plausible BAC Matches:   P168G21,   P123D19,   P228C14,   P334B22,   P089E18,   P086D03,   P309P14,   P112C14,   P291K18,   P330E10,   P194A20,   P126P21

 Overgo Sequences

A sequence
TCTTGCCCTGTATGGTAACCAGAC
B sequence
GATGCTGGTAAAGCTGGTCTGGTT
AB sequence
TCTTGCCCTGTATGGTAACCAGACCAGCTT
Marker sequence
ATAGGAAGAAACACAAAGAAATAACATTTAGTATTTAATTAATCTGTGTG
TTTTACCAATCAGATAATAGTGAAATGTGACATCTGTAAAAGCTGAATGA
TGCTAATATCAAACAGTTCTCTCTCTACACAGATACTGGTGAAGCCAAGC
AAAAGTGTAAGTGTTAATTACTTGAAGGAACCATTTGAAGAATCTGTTCT
GCTTGATCAGGGAAGAAAGTTACAAATAGAAGTGCACAGATAAGCACAGT
TCCAAGAACTGCTGAAATCTTGCCCTGTATGGTAACCAGACCAGCTTTAC
CAGCATCTTGTAGTTCCTTTGAACCGACGGAATCAAATGTTCCAGGTTTT
ACGGTCTGAAGACCTGATGTTATGCACGCTATGTTGTCATAACCTGCTCT
CTCTAATCTCTCCGCAGCAGCTGCGGACCTTAGACCCTCTTGACAGACGA
GTAAGAGCTTGCTTTGAGGAGAAAATTGAGATTTAACAGATTGCACAAAC
TCAGGATTGGGTTTAGTAAATGGCAATCC
Genomic location of T0613  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1498 marker 1498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)