SGN Marker T0619

SGN-M1502
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAE03TH
Arabidopsis best BAC match: AC006284.3
Arabidopsis position: 2.0140000
Arabidopsis identities: 0.622
Best GenBank protein hit: AAD17434.1
Evalue: 2.4e-38
Identities: 0.728
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53145)
Chromosome
5
Position
9.97 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39376)
Chromosome
5
Position
59.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0619 was used as an overgo probe on plate 12 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAAGTCATTCGTTCCGCTTTCTG
B sequence
AGAACAGCAAGGCAAGCAGAAAGC
AB sequence
CCAAGTCATTCGTTCCGCTTTCTGCTTGCC
Marker sequence
GTTTTCTTGTGCTTCCCTATCTTCTTCTTCTACTACTACTTTTTGGTCTA
GTGGAAGCAGAGCAAAAGCAGAATTATGACTATGGCTACTCCTATTTCTC
CAATGAAGCAATTCCCTTCAACTGCTCTTCAACCATTCCCATCAATCTTT
CAAAGAAAACCAGTACTAATCTCTTCACTTAGAAAAACTCCTCATCTTTT
CTCTTATTCATCTCCCAAGTCATTCGTTCCGCTTTCTGCTTGCCTTGCTG
TTCTTCTATGGTCCTCTCCTGCTAATGCTGGATTTCTTTCGGGTTATACT
GGTATAGAATCAGTTCCTGGCCCTGAATTACCTAAGATTGAGTTTCTTAA
TCGTTGGAACGATAATAATCAGAAAAAGTATGCAGAACTCGATGAAAAAT
TCAAAGAGTCGCCTTTGCTCAAACAGTTACTCGAAAAATCCAAGCAAAAT
AAAGAGAAGAACAAAAGGTCAATTGAAGACAAGTATTGTTTACGCGGAGC
TGAATGGGGAGTTGGGGATTGCTCAACAGCAGGAATGACACCAGAAGACA
GAGATAGCTTCATTGCCATGTTGAAGCACAAGGCTGGTGTAAAATGAACG
CGCAATTATGTACTACTCTNTATCGATGATGCTGGTTTCAATTTCC
Genomic location of T0619  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1502 marker 1502
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)