SGN Marker T0620

SGN-M1503
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAE05TH
Arabidopsis best BAC match: AC006438.3
Arabidopsis position: 2.0930000
Arabidopsis identities: 0.444
Best GenBank protein hit: AAD41980.1
Evalue: 3.9e-58
Identities: 0.613
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49526)
Chromosome
1
Position
87.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47460)
Chromosome
1
Position
139.57 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39377)
Chromosome
1
Position
150.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0620 was used as an overgo probe on plate 8 [well E3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGAAGGCCAATGCATATGCTGAG
B sequence
GAGCAGCACGAAGATTCTCAGCAT
AB sequence
GAGAAGGCCAATGCATATGCTGAGAATCTT
Marker sequence
CTGGCATTGCAGACAGCACAGATGAGGTGAAGAATTTGCATGATTCTAGT
GTGGACAAGGCTGCAGAATTGGCAGCAGGATTTACAAATGTTTTGGTTGG
ACTAGCTCCTAATGACATGGTTCAAAGGACTGCTCGAAGACTGGATACTC
TTCATTCAGAGGGTGTTCATAGACTTTCAGAGTTGTGTTGTTTTGCTGCG
ACTCAACTTGTAATGCTTGGGAAATCAATCATTTCAACTGCAAATAAAGT
TGGGGACCAAGATGCAAATGTGGAAATTCTGAAAATGGAATGGCCGGAGG
ATTCAATTGAAAGAGCTAAGGTAATCCGATCAAAGGCATGTTCAATGACT
CGATGTGTTGAAACAGTTTCTTCCAGCTTCATTACAGGGATATCTGAAGT
GTCTGAAGCGTATTTAGCAGCAGTGAAGAGTGTATCTGCTGATTCACATG
AGGTTCCACAGAAATCAATCCAGGAGAAGGCCAATGCATATGCTGAGAAT
CTTCGTGCTGCTCATAGCACAGCCATGGGCAAAATTCAGGACGGCCTTCA
ATATTTACCCTATGTGGTCATCTCAACCTCAATGCCTGCTGCTTGAAGAA
TTTCTCAATGCAAAATTTCACACTTAGTCCTTCCTCCTTTTAGCTTTCCT
TTTGCTCTCGCCCCGCCCT
Genomic location of T0620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1503 marker 1503
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)