SGN Marker T0628

SGN-M1507
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TMEAH15TH
Arabidopsis best BAC match: AC009325.6
Arabidopsis position: 3.0030000
Arabidopsis identities: 0.888
Best GenBank protein hit: AAA34065.1
Evalue: 3.1e-59
Identities: 0.903
Description: chloroplast carbonic anhydrase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49527)
Chromosome
2
Position
44.02 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47461)
Chromosome
2
Position
101.55 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39378)
Chromosome
2
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0628 was used as an overgo probe on plate 11 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCACATCAATGCACAGCTTGTGAG
B sequence
CGTTCACAGCTTCCTTCTCACAAG
AB sequence
GCACATCAATGCACAGCTTGTGAGAAGGAA
Marker sequence
GTACTCTGGAGTAGGAGCAGCCATTGAATACGCCGTTCTTCATCTTAAGG
TGGAGAACATCGTTGTCATTGGCCACAGTGCTTGTGGAGGTATCAAAGGT
CTCATGTCACTACCTGAAGATGGTAGTGAATCAACTGCCTTTATTGAGGA
TTGGGTAAAAATTTGTTTACCTGCCAAGGCAAAGGTTCTGGCCGATCACG
GAGGGAAAGAATTTGCACATCAATGCACAGCTTGTGAGAAGGAAGCTGTG
AACGTTTCACTTGGAAATCTGCTTACGTATCCATTCGTGAGAGAAGGATT
GGTGAAGAAAACATTGGCATTGAAGGGAGGTTACTATGATTTCTTGAAGG
GTGGATTTGAGCTGTGGGGACTTGA
Genomic location of T0628  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1507 marker 1507
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)