SGN Marker T0632

SGN-M1509
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAE36TH
Arabidopsis best BAC match: Z99707.1
Arabidopsis position: 4.1870000
Arabidopsis identities: 0.614
Best GenBank protein hit: CAB16763.1
Evalue: 1.7e-50
Identities: 0.593
Description: putative protein [Arabidopsis thaliana]/3rd red chlorophyll catabolite reductase [Hordeum vulgare] e-24
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39379)
Chromosome
3
Position
73.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0632 was used as an overgo probe on plate 9 [well E5]

Plausible BAC Matches:   P263I03,   P051P22,   P330B17,   P264O08,   P077F05,   P044H23,   P154B13,   P156E07,   P060H22,   P166G07,   P228A02

 Overgo Sequences

A sequence
GGTGGAACTTGTATCGACTGTGGA
B sequence
CTCTCCAAGACGATTCTCCACAGT
AB sequence
GGTGGAACTTGTATCGACTGTGGAGAATCG
Marker sequence
TTCCACTCTCCTCTGCCAAATTTCACACTTCAATTCTCACACAATCACTC
CCCTCTTCTTCCTCTCGTTCTTTTTCCGTCGGAAAACGCTTCTGTTGCTC
GTCGTCATCAACTTCCATGGAACATCATGAATCGAAATTTAAGGAATTTC
CTTATGCATCTGTTCCGCATAGAGAGTTAATGGTGGAACTTGTATCGACT
GTGGAGAATCGTCTTGGAGAGTCTCTACTTCCTTGTACTCTGCCTTCTCA
TGTGCAGTATTTTGAGAATGAATCTGCTACTGCTCATGCTTCTCTCTATG
TCAGATCTGGAAATTCCTCTTCTCAGGTTGATTTCATACTTGGTAGTTGG
GTTCACTGCAACTTACCCACCGGCGGAGCATTGAATATTACAAGCCTTTC
CGTATATTTGAGACCTTCAACTGATGCACCAAACTTCTTAATTGAAGTTA
TTCAAAGCAGTCCAACAACTCTCATCCTCATTCTTGATCTACCTCCGCGA
AAGGACCTTGTCCAACATCCCGATTACCTCAAGACCTTTTATGAGGAAAC
ACAATTAGATAAGCAAAGACAACTTCTCGAGAAGCTACCTGAGGTAAAGC
CTTATTTCTCTTCTTCTCTATATATTCGAGCCCTTGTCTCTCCATCAGCT
ATCTTGG
Genomic location of T0632  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1509 marker 1509
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)