SGN Marker T0633

SGN-M1510
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEAH25TH
Arabidopsis best BAC match: AL049655.2
Arabidopsis position: 3.1190000
Arabidopsis identities: 0.955
Best GenBank protein hit: AAA34140.1
Evalue: 5.9e-39
Identities: 1.000
Description: chlorophyll a/b-binding protein [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49528)
Chromosome
5
Position
64.60 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47462)
Chromosome
5
Position
137.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41618)
Chromosome
5
Position
118.90 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43586
Forward primer (5'-3')
GATGGGCTATGCTTGCTGTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATCCCCAATGTTGTTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39380)
Chromosome
5
Position
119.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35590
Forward primer (5'-3')
GATGGGCTATGCTTGCTGTT
Digested band sizes (using MseI)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 375
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACATCCCCAATGTTGTTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 375+600
Solanum pennellii LA716: 375+600
Approximate temperature
55°C
  
PCR data   Exp. ID 76
Forward primer (5'-3')
Unknown
Digested band sizes (using MseI)
Solanum pennellii LA716: 375+375
Solanum lycopersicum LA925: 350+350
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600+375
Solanum lycopersicum LA925: 600+375
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0633 was used as an overgo probe on plate 11 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAACAGGACCATTAGAGAACTTGG
B sequence
TCAGCCAAGTGAGTTGCCAAGTTC
AB sequence
GAACAGGACCATTAGAGAACTTGGCAACTC
Marker sequence
CCCTGGTGGGGCTTTTGACCCATTGGGTTACTCTAAAGACCCTGCTAAAT
TTGAAGAACTCAAAGTCAAGGAAATCAAGAATGGTCGTCTTGCATTGTTG
GCATTTGTGGGATTTTGTGTACAACAATCAGCATATCCAGGAACAGGACC
ATTAGAGAACTTGGCAACTCACTTGGCTGACCCATGGCACAACAACATTG
GGGATGTTATTATCCCTAAAGGCATTTTCCCTAATTAAATTATACTATTT
ATCATATAGTATATTAGCCAAAAAAAACACCTTGTAAAACTCTCCCATAT
TGTACTCATATAGTCTTGTAATGAAATGGACTCTTTGTGTATCCTGTGTC
TATGCATGATATCTCTATCTAAATATCCATTTTATTCGT
Genomic location of T0633  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1510 marker 1510
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)