SGN Marker T0643

SGN-M1518
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAH44TH
Arabidopsis best BAC match: AC011001.2
Arabidopsis position: 1.0181000
Arabidopsis identities: 0.625
Best GenBank protein hit: AAF24809.1
Evalue: 5.7e-46
Identities: 0.543
Description: similar to auxin-induced protein dbj|BAA10842 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49531)
Chromosome
7
Position
54.81 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47465)
Chromosome
7
Position
36.25 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39837)
Chromosome
7
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0643 was used as an overgo probe on plate 7 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTCAACTCAGGTGGTCCTGAATC
B sequence
TCCTGTGCAATCAACCGATTCAGG
AB sequence
CTTCAACTCAGGTGGTCCTGAATCGGTTGA
Marker sequence
GTCAAGGCCGCCTGTGATGAATTGGGAGTCACATTGATTGCATATTCACC
CATTGCTCAAGGAGCTTTGACTGGAAAATATACTCCAGAAAATCCTCCCA
CTGGCCCTCGCGGACAGATCTATACTCCTGAAGTTCTTACCAAATTGCAG
CCACTCATAAATAGAATAAAGGAGATTGGAGATAGCTACAATAAGACTTC
AACTCAGGTGGTCCTGAATCGGTTGATTGCACAGGAGAATGTTGTTCCCA
TCCCAGGAGCCAAAAATGCTGAGCAGGCTAAAGAATTTGGTGGTGCGTTG
GGTTGGAGACTAACCCAACAAGAAATAGACCAACTTCGTTCATTGGCATC
AGAATTAAAACCTGCTACTGGTTTCCCTGACGAAAAGTTGTAAACATCAT
TGTACATGTACATTAACAAAGTCTTTGAAATGTAACTAGTACTAATAAAG
CTGGTGCTGCTGCAACAT
Genomic location of T0643  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1518 marker 1518
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)