SGN Marker CT16

SGN-M152

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT16 image not available
Forward sequence
not available
Reverse sequence
GTGTATCTTGTAATGGAGAAGCTACCTTCTTCCTGAAGAGTTGCAAAGGGTTCTCAATTAAAGGAAAGCAATCTCTCATCTCCGTTGAGG
ATCCACAGACACCAGAAAATGACATAAGCAAGAGCTCCTTCAATTATTTTCACGTCAGATCTGCTTTTTCAATGGCTTTCACGACATTGA
CAAATGCAAAAGCCATATTTGCCCTTGGTCCCAACAGGAGTATACTTGGCACAATAATTAGACCCGATGAAGTACTAGTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1670368e-122231 (88.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53450)
Chromosome
10
Position
2.58 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43638)
Chromosome
10
Position
5.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43038)
Chromosome
10
Position
6.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42953)
Chromosome
10
Position
4.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43953
Forward primer (5'-3')
TGGACGCAAACTAAATACATCAGA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GACTGCTATGCCCGTTTTCCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42305)
Chromosome
4
Position
28.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38985)
Chromosome
10
Position
7.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8326)
Chromosome
4
Position
7.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8325)
Chromosome
10
Position
8.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8330)
Chromosome
10
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT16 was used as an overgo probe on plate 5 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCAATCTCTCATCTCCGTTGAGGA
B sequence
TTCTGGTGTCTGTGGATCCTCAAC
AB sequence
GCAATCTCTCATCTCCGTTGAGGATCCACA
Marker sequence
GTGTATCTTGTAATGGAGAAGCTACCTTCTTCCTGAAGAGTTGCAAAGGG
TTCTCAATTAAAGGAAAGCAATCTCTCATCTCCGTTGAGGATCCACAGAC
ACCAGAAAATGACATAAGCAAGAGCTCCTTCAATTATTTTCACGTCAGAT
CTGCTTTTTCAATGGCTTTCACGACATTGACAAATGCAAAAGCCATATTT
GCCCTTGGTCCCAACAGGAGTATACTTGGCACAATAATTAGACCCGATGA
AGTACTAGTG
Genomic location of CT16  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D152 marker 152
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)