SGN Marker T0648

SGN-M1521
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAG49TH
Arabidopsis best BAC match: AB018109.1
Arabidopsis position: 5.1980000
Arabidopsis identities: 0.611
Best GenBank protein hit: BAB08670.1
Evalue: 9.9e-21
Identities: 0.567
Description: contains similarity to endopeptidase~gene_id:K17N15.9 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39385)
Chromosome
3
Position
74.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0648 was used as an overgo probe on plate 7 [well H9]

Plausible BAC Matches:   P096J22,   P334A22

 Non-Plausible BAC matches

P311M21,   P079N06,   P027P16

 Overgo Sequences

A sequence
CACCACATACCAAGAGACCTCATC
B sequence
GGGAGGAGAAGATGAAGATGAGGT
AB sequence
CACCACATACCAAGAGACCTCATCTTCATC
Marker sequence
GTAAACTGAAAATGGCGCTACTACTGAACTCACCACATACCAAGAGACCT
CATCTTCATCTTCTCCTCCCTCAACCACATCAACACTCCAACCCCAGAAA
TTTCTCCATCAAATTCCAAAACTCTTCTTCTGATAATTCTTCAGAGGACA
CTGCATCATCTCCGGTAGCTAAGAAGGCAGCCAGCTCCACTTCTTTAGGT
TTTGGGTCATCGGTTTCCACCACAGTAAAGAAGAAACAACAAAAGGGGAA
AAGAGAGAGGGATACAATTATCCGACGAGAACCCATTCAAAAGCCCAGCT
TAGCTACCCAACCGGCGGAAGAATCTGGATCCAAGGAATTTCAGAAAAAT
GAGAGTGCGTTTCTTCTTGCTTGGTTAGGACTTGGTGGAATTATCCTTGT
CGAGGGTATTCTTCTTGCTGCTTCAGGCCTTTTACCAGAAGCTTGGGACA
ACTTTTTTGTGAAGTATCTGTATCCATCCTTTACTCCGACGGTCTTCCTG
TTTGTGGCTGGAACAGTTGGTTATGGAGTGTTGAAGTACCTGCAGAATGA
GAAATTTAATAGTGAAAACTGATGTTTTTTTGCATGTTATATCAAATATT
TAAGTAACTTTAATTAGTTTGGTCAGTCATGTAAAAC
Genomic location of T0648  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1521 marker 1521
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)