SGN Marker TG18

SGN-M153

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATTGAAGCTTTCTTGTTCCCATTAAGGGTTGTTGATTCCGTCAAATGCATCTAACTTGCAGCTATCCTTTATATGAATAACTTGCAGCTA
TAAATGGTTTTGAACATGTTGGCAAAAATGTGCATTCTTTGCCGACTTTATCCCAAAATCTGTTAAACGAGACTAATTTACAGAGTTGTA
TGAAACTCAAGCTCCAGCTGTTTCCTGTTGATGAAGGAACTAGAAGATCCCTGGAAATGGTAGGTTAAGTAAATCTCTTTGCTGTTCTGT
CATTAATTGGTTATAACATCTGATGTAAAACTTATTTGCCATCACTTCTCTTTCCATTCTGTGTCAGGATAATCATAACCCTTACTTGGA
GCTCACTCTAAGTAATCGAAAAAAGATGTCATCCGTTTTGGAGCATCTCAATCGTAAATGGGGAAGTTCGAGCATAGCAACTGGAGAACT
GGTGCTTTTTCCTTACCATGTACAGATGGAAAACCTGGTGCAATCCCTGAGATGGAC
Reverse sequence
AAACTGATAGCTTTATTTACCGATCAGACACAAACGAGCTAAGTGAAGAATGTATTACAATATCCCTTGAGTTTCACTAAATCGGGTACT
GAGTACCAGTTCTTTAATGGCTGATCTGAAGGGGACAATTTCTTATTATCTAATAGTGCTCCTTCTGCAATGGGTAATTTAACAGGAGGG
ATTTTACTGATCATTTTAGAGATATCCGGATCAACTACTCAGGCTTTTAGCCTTTGGGCAATCTTTCGAATAAATTAGACTGTAAAAATT
AACTCAAATATTTTTCACGGGACAAACTTCTCAAGACAGCAGCAGAGGATCAGTCCAGTCTAAATTGGGAATAACACTTGGTTCCTAGAT
CCCCTCAATCACTCCCTCTAGAGCAGTGAGCTTAAAGTAGGCTGGTTTTCTACTTGGACCAATTTTGTCAATAATTTGCTCCCTGATCAT
ATCAACATATCTTCATGATAAGTGCCCTCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1578305.6e-78154 (30.4% of RFLP seq)+
SGN-U1578301.7e-90171 (33.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53206)
Chromosome
6
Position
7.50 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53203)
Chromosome
9
Position
51.28 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43843)
Chromosome
9
Position
10.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43303)
Chromosome
9
Position
8.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42414)
Chromosome
9
Position
14.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39927)
Chromosome
9
Position
14.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8335)
Chromosome
9
Position
58.09 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 8332)
Chromosome
9
Position
15.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8331)
Chromosome
9
Position
14.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8337)
Chromosome
9
Position
8.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35616
Forward primer (5'-3')
AAGGGTTGTTGATTCCGTCA
Digested band sizes (using RsaI)
Solanum pennellii LA716: 200
Solanum lycopersicum LA925: 468
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCACCAGGTTTTCCATCTGT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 468
Solanum lycopersicum LA925: 468
Approximate temperature
55°C
  
PCR data   Exp. ID 109
Forward primer (5'-3')
Unknown
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 468
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 468
Solanum pennellii LA716: 468
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG18 was used as an overgo probe on plate 14 [well E12]

Plausible BAC Matches:   P041G07,   P124K07,   P141K03,   P116C14,   P114D10,   P191P18,   P176P21,   P181C24

 Overgo Sequences

A sequence
CCAGCTGTTTCCTGTTGATGAAGG
B sequence
CAGGGATCTTCTAGTTCCTTCATC
AB sequence
CCAGCTGTTTCCTGTTGATGAAGGAACTAG
Marker sequence
ATTGAAGCTTTCTTGTTCCCATTAAGGGTTGTTGATTCCGTCAAATGCAT
CTAACTTGCAGCTATCCTTTATATGAATAACTTGCAGCTATAAATGGTTT
TGAACATGTTGGCAAAAATGTGCATTCTTTGCCGACTTTATCCCAAAATC
TGTTAAACGAGACTAATTTACAGAGTTGTATGAAACTCAAGCTCCAGCTG
TTTCCTGTTGATGAAGGAACTAGAAGATCCCTGGAAATGGTAGGTTAAGT
AAATCTCTTTGCTGTTCTGTCATTAATTGGTTATAACATCTGATGTAAAA
CTTATTTGCCATCACTTCTCTTTCCATTCTGTGTCAGGATAATCATAACC
CTTACTTGGAGCTCACTCTAAGTAATCGAAAAAAGATGTCATCCGTTTTG
GAGCATCTCAATCGTAAATGGGGAAGTTCGAGCATAGCAACTGGAGAACT
GGTGCTTTTTCCTTACCATGTACAGATGGAAAACCTGGTGCAATCCCTGA
GATGGAC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D153 marker 153
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)