SGN Marker T0661

SGN-M1530
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TMEAG78TH
Arabidopsis best BAC match: AC006234.3
Arabidopsis position: 2.1200000
Arabidopsis identities: 0.779
Best GenBank protein hit: AAD20926.1
Evalue: 1.8e-48
Identities: 0.779
Description: putative riboflavin synthase alpha chain [Arabidopsis thaliana]
Comment: "Biosynthesis of cofactors, prosthetic groups, and carriers "
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39842)
Chromosome
7
Position
43.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0661 was used as an overgo probe on plate 8 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTGCTGTGGATGGGACTAGTTTG
B sequence
CCACATCGTCAACAGTCAAACTAG
AB sequence
ATTGCTGTGGATGGGACTAGTTTGACTGTT
Marker sequence
CGGTGAATCTGGAGAGGGCTTTGAGGCCTAGTACTATAATGGGGGGTCAT
TTTGTGCAGGGACATGTTGATGGGACTGGTGAGATTGTTGAGCTCAAAAC
TGAAGGGGATTCTTTGTGGGTGAAGGTGAAGACTGCTAAAGAGATTTTGA
GGTACATTGTGCCAAAAGGATTCATTGCTGTGGATGGGACTAGTTTGACT
GTTGACGATGTGGTTGATGAAGAAGGCTGTTTTAACTTCATGTTGGTGGC
GTACACGCAGCAGAATGTGGTGATTCCATTGAAGAAAGTGGGGCAGAAGG
TTAATCTTGAGGTGGATATATTGGGAAAGTATGTGGAGAGGCTTCTTACT
ATTGGCTTTGTGGATTTCATCAAATCTTCATGAAAAGAGATGCTGCTTTC
CCAATTGTCT
Genomic location of T0661  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1530 marker 1530
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)