SGN Marker T0664

SGN-M1532
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.01
Tomato EST read: TMEAE90TH
Arabidopsis best BAC match: AC009465.5
Arabidopsis position: 3.0080000
Arabidopsis identities: 0.857
Best GenBank protein hit: AAF13698.1
Evalue: 1e-104
Identities: 1.000
Description: zeta-carotene desaturase [Lycopersicon esculentum]
Comment: isoprenoid compounds with role in light absorption and photoprotection
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49533)
Chromosome
1
Position
80.28 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47467)
Chromosome
1
Position
96.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40812)
Chromosome
1
Position
111.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39388)
Chromosome
1
Position
100.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0664 was used as an overgo probe on plate 1 [well D10]

Plausible BAC Matches:   P169H23

 Overgo Sequences

A sequence
ACCGTACAACTACGCTACAATGGC
B sequence
GCAACTCTGTAACCCAGCCATTGT
AB sequence
ACCGTACAACTACGCTACAATGGCTGGGTT
Marker sequence
GTTACCGTACAACTACGCTACAATGGCTGGGTTACAGAGTTGCAGGACTT
GGAGCGTTCGAGGCAATTGAAGCGCGCTGCAGGATTGGACAATCTCCTCT
ATACGCCAGATGCAGATTTCTCTTGCTTTGCAGATCTTGCATTGGCATCT
CCAGATGATTACTACATTGAGGGACAAGGCTCATTGCTTCAATGTGTCCT
TACACCTGGTGACCCTTACATGCCTCTATCAAATGATGAAATCATTAAAA
GAGTTACAAAGCAGGTTTTGGCATTATTTCCTTCGTCCCAAGGTCTTGAG
GTTACCTGGTCATCAGTTTTGAAGATAGGACAATCTTTATATCGTGAAGG
ACCTGGTAAAGACCCATTCAGACCTGATCAGAAGACGCCAGTGGAAAATT
TCTTTCTTGCTGGCTCATATACAAAACAGGACTACATCGATAGCATGGAA
GGAGCAACTCTTTCAGGTAGGCAAGCTTCTGCATACATATGTAATGTTGG
AGAGCAGCTGATGGCGTTGCGTAAAAAGATCACTGCTGCTGAGTTGAATG
ACATCTCTAAAGGTGTGTCCCTATCTGATGAGTTGAGTCTTGTCTGATGA
CAGACTGCAAATCATCCAAATACAACTCAGTTAGGCATCGCACAAGGAAG
AATTCTTCTAA
Genomic location of T0664  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1532 marker 1532
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)