SGN Marker T0668

SGN-M1533
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TMEAG89TH
Arabidopsis best BAC match: AL035396.1
Arabidopsis position: 4.1280000
Arabidopsis identities: 0.825
Best GenBank protein hit: AAF70243.1
Evalue: 1.6e-73
Identities: 0.971
Description: S-adenosyl-L-methionine Mg-protoporphyrin IX [Nicotiana tabacum]
Comment: involved in chlorophyll biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39843)
Chromosome
3
Position
137.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0668 was used as an overgo probe on plate 16 [well G12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGACGGAAGAGGGATCTCTACAG
B sequence
CACATACAGTAACTCCCTGTAGAG
AB sequence
TTGACGGAAGAGGGATCTCTACAGGGAGTT
Marker sequence
CGAGCGCCGGCGGCAACTTCAGGCGGAGGAGGTCGGAGGCGGTGATAAGG
AGGTGGTGAGGGAGTATTTCAATAACAATGGATTCCAGAGGTGGAAGAAG
ATATATGGTGATACGGATGATGTGAATAAAGTGCAGTTGGATATAAGATT
GGGACATTCAAAAACGGTTGAGAATGTGATGAAAATGTTGACGGAAGAGG
GATCTCTACAGGGAGTTACTGTATGTGACGCCGGTTGTGGGACCGGTTGT
TTGTCGATTCCGATAGCTAAAGAAGGTGCCATTGTATCAGCTAGTGACAT
TTCAGCTTCCATGGTAGCTGAAGCCCAAAAACAGGCGCAAGAGGAGTTGT
TCAAGGGTAAAGATGACCAATCCCTGGCACCAGTAATGCCGAAATTTGAA
GTGAAGGACTTGGAGAGTTTGCATGG
Genomic location of T0668  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1533 marker 1533
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)