SGN Marker TGS1998

SGN-M15364

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50774)
Chromosome
4
Position
60.62 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48707)
Chromosome
4
Position
84.93 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45811
Forward primer (5'-3')
GATTAACGGCGAGGTTGACTG
Accessions and product sizes
Solanum lycopersicum LA925
262
Solanum pennellii LA716
257
Approximate temperature
55°C
Reverse primer (5'-3')
TCGGGCATATTTCTGATTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS1998  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15364 marker 15364
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)