SGN Marker T0675

SGN-M1537
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01
Tomato EST read: TMEAI08TH
Arabidopsis best BAC match: AC010704.4
Arabidopsis position: 1.1480000
Arabidopsis identities: 0.882
Best GenBank protein hit: AAF07797.1
Evalue: 1.2e-78
Identities: 0.813
Description: putative aminotransferase; 101422-99564 [Arabidopsis thaliana]
Comment: unclear what type of aminotransferase activity
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49535)
Chromosome
11
Position
6.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47469)
Chromosome
11
Position
62.08 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39390)
Chromosome
11
Position
42.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0675 was used as an overgo probe on plate 10 [well A9]

Plausible BAC Matches:   P172B15

 Overgo Sequences

A sequence
TTCTACAATGGCCACCGCTTCAAC
B sequence
AGCGACATCATTCTGGGTTGAAGC
AB sequence
TTCTACAATGGCCACCGCTTCAACCCAGAA
Marker sequence
CATTGTAGAGCTTTAAACCCTACATTCTTCGCAATTTTCCCACAAAATAC
TCTTCTACAATGGCCACCGCTTCAACCCAGAATGATGTCGCTGTTTCTAC
TCAAGATAAGTCAACCCACATACTTCCTAAGCCTATTCAGGTTGCCAAGC
GCCTAGAGAAGTTCAAAACTACAATTTTCACCCAGATGAGCATGCTAGCC
ATCAAGCATGGAGCTATCAACCTCGGCCAGGGCTTCCCCAACTTTGACGG
CCCGGATTTTGTTAAAGAAGCGGCTATTCAATCTATTAAGGAAGGTAAAA
ATCAGTATGCTCGAGGATATGGAGTCCCAGACCTCAACTCTGCTGTGGCT
GCTAGATTCAAGAAAGACAGTGGTCTTGATGTTGACCCCGAAAAGGAAGT
CACTGTGACTTCAGGCTGTACTGAAGCAATTGCTGCCACCATGTTGGGTT
TGATAAATCCTGGTGATGAGGTCATCCTGTTTGCTCCTTTCTATGATTCT
TATGAAGCTACTTTATCTATGGCTGGAGCAAAGATAAAGGGTATTACTTT
AAGACCACGAGATTTTTCTCTTTCGATTGAGGAGCTAAAATCAGCAGTAT
C
Genomic location of T0675  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1537 marker 1537
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)