SGN Marker T0676

SGN-M1538
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI14TH
Arabidopsis best BAC match: AC013483.5
Arabidopsis position: 3.0121000
Arabidopsis identities: 0.865
Best GenBank protein hit: AAF21180.1
Evalue: 5e-110
Identities: 0.876
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49536)
Chromosome
7
Position
55.83 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47470)
Chromosome
7
Position
38.87 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39845)
Chromosome
7
Position
38.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0676 was used as an overgo probe on plate 10 [well E5]

Plausible BAC Matches:   P311C01,   P217K22,   P218P17,   P069G15,   P035E04,   P217M22

 Overgo Sequences

A sequence
AAACAGCTTGAGTCCGGAGATCTG
B sequence
CCCGAACTCTGAGTTTCAGATCTC
AB sequence
AAACAGCTTGAGTCCGGAGATCTGAAACTC
Marker sequence
CCATGCTGATCCACATCCAGGGAATCTTGCAATTGATGTTGACGAAGCTT
TAATCTATTATGATTTTGGTATGATGGGAGACATCAAGAATTTCACAAGA
GAGAGGTTGCTGGGACTTTTTTATTCTGTCTACGAAAAGGATGCAAAAAA
GGTTATGCAAGGGCTTATTGATCTTGAAGCACTTCAGCCCACAGGAGACA
TGTCAGCTGTGAGGAGATCTGTTCAGTTTTTCTTGGACAACTTGTTGAAC
CAAAGACCAGATCAGCAGCAAACTTTGGCTGCAATTGGTGAGGATTTGTT
TGCTATAGCAACTGATCAACCATTCCGTTTCCCTTCCACTTTTACATTTG
TGCTCAGGGCATTTTCCACACTAGAAGGGATTGGCTATATATTGGATCCT
AATTTCTCCTTCCCTAAGATTGCAGCACCATATGCACAGGAGCTCTTGGA
CTTGAGACAGCAGCAGCGCAGTGGTCCACAACTTGTTCAGGAAATAAGGA
AACAGGCTAATGATGCACGGACATCCACCATTTCCATGCCTTACAGAGTC
CAGCAGATAGAAGAGATCGTTAAACAGCTTGAGTCCGGAGATCTGAAACT
CAGAGTTCGGGTCCTCGAGTCTGAGAGAGCAGCTCGAAAAGCTACAATTC
TTCAAATGGCAACCATGTACACAGTCATAGGGGGCACCCTTCTAAACCTT
GGTGGCACTTTTACCAGTC
Genomic location of T0676  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1538 marker 1538
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)