SGN Marker TG394

SGN-M154

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTTCTTTTGAATCTTAAATTCCAGTGAATTAGCCTCATGAGACCTACAAATTTGTTGGACTGTCATCTCTCTGAAAAGATACACTATAT
ATGTTAGAGATGGCTTCCTATCATATAGTTTGTATAGTCTTTTTAATTTACTAAGAATGTCCAACCTTGTTTGAGGGAATAACAGAGTTT
TACAATCTTTTCATTCTATTTTATATAATAGTGCATTCTCAAGTTCATCAAAGGAGTAAACTTTAGCATATTGTTTGTTATATCAAGACA
TGGATCTTTCACGAAGTGTTGGATGCTATGATGTAGATTGAACAAGTTCTCCTTTATAAAGGGAGGTAGAAGATTGTGCTGTACCCCTTT
TAGCTTGTGAATTTCTCTAGCCAAAACAGCTTCTACAAGAGTTTATGTATAATGAAATTAAACAGATGAAGCTGATATTTTAGTCAATTT
GGCCCTTCAGA
Reverse sequence
TCATATACCTGGACAAAGGCATTCTGATGTATTCTTCAGTAGGGCAGCTTGAAGTACTTGATCTCCAGCTACCATCATATTTGTAACGTC
TACTGGAGATGCATAGAACATTAATAGCTTAGCTATTTTATCTGCCCCAGCTTAAGATAGATCTCCAATCCAAAGGAACAAAAGAAATTC
CTGAAACATTGTAAGCATACCAGTAGATGCTGAACATGAGTTCTCAGACAATCCCAGATGAAGATCTAGATTTGGTTGAATCAGTTCATT
ACACAAGTCTGTCGATGCATCAGACTTCACACCCACAGGGGTAGCAGGCTGCGCAGAATCTGGACATTCATTTTGTCGCAAGGACAGTTC
TATACTGGAAGTATCAGGAACAGGATCAGGGACCAAAATGCCAGTATTTATAGCCTCTTTAGTATCTAGATTTGAAAGTTTTCTGCCTGG
TATTTCACCCTGATTGTTCCTCTCAACAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50382)
Chromosome
12
Position
47.26 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48316)
Chromosome
12
Position
66.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42454)
Chromosome
5
Position
66.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40026)
Chromosome
12
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8339)
Chromosome
5
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8338)
Chromosome
12
Position
47.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG394 was used as an overgo probe on plate 4 [well G4]

Plausible BAC Matches:   P042O05,   P004J02,   P025M21,   P107D15,   P008G21,   P046F10,   P315B11,   P022D20,   P106J18,   P121A09,   P245J15,   P215C23,   P336P05,   P242G04,   P063E16,   P225M17,   P165B12

 Non-Plausible BAC matches

P171J11,   P321C23,   P190J18,   P043C23,   P298O16,   P002P15,   P120L04,   P042D06

 Overgo Sequences

A sequence
CCAGTGAATTAGCCTCATGAGACC
B sequence
GTCCAACAAATTTGTAGGTCTCAT
AB sequence
CCAGTGAATTAGCCTCATGAGACCTACAAA
Marker sequence
TTTTCTTTTGAATCTTAAATTCCAGTGAATTAGCCTCATGAGACCTACAA
ATTTGTTGGACTGTCATCTCTCTGAAAAGATACACTATATATGTTAGAGA
TGGCTTCCTATCATATAGTTTGTATAGTCTTTTTAATTTACTAAGAATGT
CCAACCTTGTTTGAGGGAATAACAGAGTTTTACAATCTTTTCATTCTATT
TTATATAATAGTGCATTCTCAAGTTCATCAAAGGAGTAAACTTTAGCATA
TTGTTTGTTATATCAAGACATGGATCTTTCACGAAGTGTTGGATGCTATG
ATGTAGATTGAACAAGTTCTCCTTTATAAAGGGAGGTAGAAGATTGTGCT
GTA
Genomic location of TG394  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D154 marker 154
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)